Incidental Mutation 'R1364:Mid1'
ID233290
Institutional Source Beutler Lab
Gene Symbol Mid1
Ensembl Gene ENSMUSG00000035299
Gene Namemidline 1
Synonyms61B3-R, Trim18, DXHXS1141, Fxy
MMRRC Submission 039429-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1364 (G1)
Quality Score21
Status Validated
ChromosomeX
Chromosomal Location169685199-170005736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 169986094 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 215 (N215H)
Ref Sequence ENSEMBL: ENSMUSP00000078412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036753] [ENSMUST00000078947] [ENSMUST00000079443] [ENSMUST00000112104] [ENSMUST00000112105] [ENSMUST00000112107] [ENSMUST00000163810] [ENSMUST00000171433]
Predicted Effect probably benign
Transcript: ENSMUST00000036753
AA Change: N495H

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038765
Gene: ENSMUSG00000035299
AA Change: N495H

DomainStartEndE-ValueType
RING 10 59 4.41e-6 SMART
BBOX 114 164 2.8e-8 SMART
BBOX 170 212 9.8e-13 SMART
BBC 219 345 1.5e-16 SMART
FN3 381 485 1.53e-6 SMART
Pfam:PRY 499 548 7.3e-11 PFAM
SPRY 551 670 1.12e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078947
AA Change: N457H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077974
Gene: ENSMUSG00000035299
AA Change: N457H

DomainStartEndE-ValueType
RING 10 59 4.41e-6 SMART
BBOX 114 164 2.8e-8 SMART
BBC 181 307 1.47e-15 SMART
FN3 343 447 1.53e-6 SMART
Pfam:PRY 461 510 2.6e-11 PFAM
SPRY 513 632 1.12e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079443
AA Change: N215H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078412
Gene: ENSMUSG00000035299
AA Change: N215H

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:BBC 21 78 1e-29 BLAST
FN3 114 205 1.91e-7 SMART
Pfam:PRY 219 268 5.1e-11 PFAM
SPRY 271 390 1.12e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112104
AA Change: N495H

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107732
Gene: ENSMUSG00000035299
AA Change: N495H

DomainStartEndE-ValueType
RING 10 59 4.41e-6 SMART
BBOX 114 164 2.8e-8 SMART
BBOX 170 212 9.8e-13 SMART
BBC 219 345 1.5e-16 SMART
FN3 381 485 1.53e-6 SMART
Pfam:PRY 499 548 7.3e-11 PFAM
SPRY 551 670 1.12e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112105
AA Change: N495H

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107733
Gene: ENSMUSG00000035299
AA Change: N495H

DomainStartEndE-ValueType
RING 10 59 4.41e-6 SMART
BBOX 114 164 2.8e-8 SMART
BBOX 170 212 9.8e-13 SMART
BBC 219 345 1.5e-16 SMART
FN3 381 485 1.53e-6 SMART
Pfam:PRY 499 548 9.4e-12 PFAM
SPRY 551 670 1.12e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112107
AA Change: N289H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107735
Gene: ENSMUSG00000035299
AA Change: N289H

DomainStartEndE-ValueType
BBC 13 139 5.05e-14 SMART
FN3 175 279 1.53e-6 SMART
Pfam:PRY 293 342 1.7e-11 PFAM
SPRY 345 464 1.12e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152163
Predicted Effect probably benign
Transcript: ENSMUST00000163810
AA Change: N495H

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128176
Gene: ENSMUSG00000035299
AA Change: N495H

DomainStartEndE-ValueType
RING 10 59 4.41e-6 SMART
BBOX 114 164 2.8e-8 SMART
BBOX 170 212 9.8e-13 SMART
BBC 219 345 1.5e-16 SMART
FN3 381 485 1.53e-6 SMART
Pfam:PRY 499 548 7.3e-11 PFAM
SPRY 551 670 1.12e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171433
AA Change: N495H

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126746
Gene: ENSMUSG00000035299
AA Change: N495H

DomainStartEndE-ValueType
RING 10 59 4.41e-6 SMART
BBOX 114 164 2.8e-8 SMART
BBOX 170 212 9.8e-13 SMART
BBC 219 345 1.5e-16 SMART
FN3 381 485 1.53e-6 SMART
Pfam:PRY 499 548 7.3e-11 PFAM
SPRY 551 670 1.12e-31 SMART
Meta Mutation Damage Score 0.0264 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.8%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein forms homodimers which associate with microtubules in the cytoplasm. The protein is likely involved in the formation of multiprotein structures acting as anchor points to microtubules. Mutations in this gene have been associated with the X-linked form of Opitz syndrome, which is characterized by midline abnormalities such as cleft lip, laryngeal cleft, heart defects, hypospadias, and agenesis of the corpus callosum. This gene was also the first example of a gene subject to X inactivation in human while escaping it in mouse. Alternative promoter use, alternative splicing and alternative polyadenylation result in multiple transcript variants that have different tissue specificities. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous or hemizygous for disruptions in this gene have a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,987,030 F2519S probably damaging Het
Ahi1 T A 10: 20,972,156 L488I probably damaging Het
Cobll1 A G 2: 65,126,310 probably benign Het
Csn1s1 T C 5: 87,677,584 probably benign Het
D430041D05Rik A T 2: 104,155,018 S1920T possibly damaging Het
Dnah17 T A 11: 118,125,606 probably benign Het
Fam126a T C 5: 23,965,353 T333A probably benign Het
Fanca G A 8: 123,304,281 probably benign Het
Fnbp1 T C 2: 31,059,031 probably benign Het
Herc1 T A 9: 66,400,093 L1023Q probably damaging Het
Hjurp T TN 1: 88,266,525 probably null Het
Kcnt1 A G 2: 25,908,094 M906V probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mug1 T A 6: 121,881,713 L1130Q probably damaging Het
Nebl A T 2: 17,393,037 probably benign Het
Olfr1491 T C 19: 13,705,445 V206A probably benign Het
Otud7b A G 3: 96,151,451 D320G probably damaging Het
Piezo1 T C 8: 122,498,571 E563G possibly damaging Het
Prkd3 T C 17: 78,957,258 T643A probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rasl10b G A 11: 83,417,839 probably null Het
Ripk3 A C 14: 55,785,260 probably null Het
Sgsm3 T C 15: 81,007,942 F237S probably damaging Het
Slit3 G A 11: 35,670,107 V960I probably benign Het
Sptbn2 T C 19: 4,732,665 L543P probably damaging Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Unkl A G 17: 25,189,623 I54V probably benign Het
Wdr75 A G 1: 45,799,062 T44A probably benign Het
Other mutations in Mid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02590:Mid1 APN X 169927023 missense probably damaging 1.00
LCD18:Mid1 UTSW X 170005564 unclassified probably benign
R1317:Mid1 UTSW X 169986094 missense probably damaging 1.00
R1366:Mid1 UTSW X 169986094 missense probably damaging 1.00
R4452:Mid1 UTSW X 169927425 missense possibly damaging 0.62
R4678:Mid1 UTSW X 169985048 missense possibly damaging 0.79
R7100:Mid1 UTSW X 169985077 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TCTGTGTAACTCGGCGGACAGC -3'
(R):5'- ACCCTGAGTGACCATGTGAGGC -3'

Sequencing Primer
(F):5'- ATCTTCACGGTGAAGGCCAT -3'
(R):5'- TGTGAGACATGGGGATGACTG -3'
Posted On2014-10-01