Mutagenetix > Incidental Mutation

Incidental Mutation 'R1364:Mid1'

233290

Institutional Source

Beutler Lab

Gene Symbol

Mid1

Ensembl Gene

ENSMUSG00000035299

Gene Name

midline 1

Synonyms

Fxy, Trim18, 61B3-R, DXHXS1141

MMRRC Submission

039429-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1364 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

168468178-168773794 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 168769090 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Histidine at position 215 (N215H)

Ref Sequence

ENSEMBL: ENSMUSP00000078412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036753] [ENSMUST00000078947] [ENSMUST00000079443] [ENSMUST00000112104] [ENSMUST00000112105] [ENSMUST00000112107] [ENSMUST00000171433] [ENSMUST00000163810]

AlphaFold

O70583

Predicted Effect

probably benign
Transcript: ENSMUST00000036753
AA Change: N495H

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000038765
Gene: ENSMUSG00000035299
AA Change: N495H

Domain	Start	End	E-Value	Type
RING	10	59	4.41e-6	SMART
BBOX	114	164	2.8e-8	SMART
BBOX	170	212	9.8e-13	SMART
BBC	219	345	1.5e-16	SMART
FN3	381	485	1.53e-6	SMART
Pfam:PRY	499	548	7.3e-11	PFAM
SPRY	551	670	1.12e-31	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000078947
AA Change: N457H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000077974
Gene: ENSMUSG00000035299
AA Change: N457H

Domain	Start	End	E-Value	Type
RING	10	59	4.41e-6	SMART
BBOX	114	164	2.8e-8	SMART
BBC	181	307	1.47e-15	SMART
FN3	343	447	1.53e-6	SMART
Pfam:PRY	461	510	2.6e-11	PFAM
SPRY	513	632	1.12e-31	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000079443
AA Change: N215H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000078412
Gene: ENSMUSG00000035299
AA Change: N215H

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Blast:BBC	21	78	1e-29	BLAST
FN3	114	205	1.91e-7	SMART
Pfam:PRY	219	268	5.1e-11	PFAM
SPRY	271	390	1.12e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112104
AA Change: N495H

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000107732
Gene: ENSMUSG00000035299
AA Change: N495H

Domain	Start	End	E-Value	Type
RING	10	59	4.41e-6	SMART
BBOX	114	164	2.8e-8	SMART
BBOX	170	212	9.8e-13	SMART
BBC	219	345	1.5e-16	SMART
FN3	381	485	1.53e-6	SMART
Pfam:PRY	499	548	7.3e-11	PFAM
SPRY	551	670	1.12e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112105
AA Change: N495H

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000107733
Gene: ENSMUSG00000035299
AA Change: N495H

Domain	Start	End	E-Value	Type
RING	10	59	4.41e-6	SMART
BBOX	114	164	2.8e-8	SMART
BBOX	170	212	9.8e-13	SMART
BBC	219	345	1.5e-16	SMART
FN3	381	485	1.53e-6	SMART
Pfam:PRY	499	548	9.4e-12	PFAM
SPRY	551	670	1.12e-31	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112107
AA Change: N289H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107735
Gene: ENSMUSG00000035299
AA Change: N289H

Domain	Start	End	E-Value	Type
BBC	13	139	5.05e-14	SMART
FN3	175	279	1.53e-6	SMART
Pfam:PRY	293	342	1.7e-11	PFAM
SPRY	345	464	1.12e-31	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124513

Predicted Effect

probably benign
Transcript: ENSMUST00000171433
AA Change: N495H

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000126746
Gene: ENSMUSG00000035299
AA Change: N495H

Domain	Start	End	E-Value	Type
RING	10	59	4.41e-6	SMART
BBOX	114	164	2.8e-8	SMART
BBOX	170	212	9.8e-13	SMART
BBC	219	345	1.5e-16	SMART
FN3	381	485	1.53e-6	SMART
Pfam:PRY	499	548	7.3e-11	PFAM
SPRY	551	670	1.12e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163810
AA Change: N495H

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000128176
Gene: ENSMUSG00000035299
AA Change: N495H

Domain	Start	End	E-Value	Type
RING	10	59	4.41e-6	SMART
BBOX	114	164	2.8e-8	SMART
BBOX	170	212	9.8e-13	SMART
BBC	219	345	1.5e-16	SMART
FN3	381	485	1.53e-6	SMART
Pfam:PRY	499	548	7.3e-11	PFAM
SPRY	551	670	1.12e-31	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152163

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143815

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146073

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144738

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133857

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151722

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129642

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.8%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also known as the 'RING-B box-coiled coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein forms homodimers which associate with microtubules in the cytoplasm. The protein is likely involved in the formation of multiprotein structures acting as anchor points to microtubules. Mutations in this gene have been associated with the X-linked form of Opitz syndrome, which is characterized by midline abnormalities such as cleft lip, laryngeal cleft, heart defects, hypospadias, and agenesis of the corpus callosum. This gene was also the first example of a gene subject to X inactivation in human while escaping it in mouse. Alternative promoter use, alternative splicing and alternative polyadenylation result in multiple transcript variants that have different tissue specificities. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous or hemizygous for disruptions in this gene have a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahi1	T	A	10: 20,848,055 (GRCm39)	L488I	probably damaging	Het
Bltp1	T	C	3: 37,041,179 (GRCm39)	F2519S	probably damaging	Het
Cobll1	A	G	2: 64,956,654 (GRCm39)		probably benign	Het
Csn1s1	T	C	5: 87,825,443 (GRCm39)		probably benign	Het
D430041D05Rik	A	T	2: 103,985,363 (GRCm39)	S1920T	possibly damaging	Het
Dnah17	T	A	11: 118,016,432 (GRCm39)		probably benign	Het
Fanca	G	A	8: 124,031,020 (GRCm39)		probably benign	Het
Fnbp1	T	C	2: 30,949,043 (GRCm39)		probably benign	Het
Herc1	T	A	9: 66,307,375 (GRCm39)	L1023Q	probably damaging	Het
Hjurp	T	TN	1: 88,194,247 (GRCm39)		probably null	Het
Hycc1	T	C	5: 24,170,351 (GRCm39)	T333A	probably benign	Het
Kcnt1	A	G	2: 25,798,106 (GRCm39)	M906V	probably damaging	Het
Mfsd13a	C	T	19: 46,354,943 (GRCm39)	T40I	probably benign	Het
Mug1	T	A	6: 121,858,672 (GRCm39)	L1130Q	probably damaging	Het
Nebl	A	T	2: 17,397,848 (GRCm39)		probably benign	Het
Or10q1b	T	C	19: 13,682,809 (GRCm39)	V206A	probably benign	Het
Otud7b	A	G	3: 96,058,768 (GRCm39)	D320G	probably damaging	Het
Piezo1	T	C	8: 123,225,310 (GRCm39)	E563G	possibly damaging	Het
Prkd3	T	C	17: 79,264,687 (GRCm39)	T643A	probably damaging	Het
Prl3b1	G	A	13: 27,427,848 (GRCm39)	A53T	probably benign	Het
Rasl10b	G	A	11: 83,308,665 (GRCm39)		probably null	Het
Ripk3	A	C	14: 56,022,717 (GRCm39)		probably null	Het
Sgsm3	T	C	15: 80,892,143 (GRCm39)	F237S	probably damaging	Het
Slit3	G	A	11: 35,560,934 (GRCm39)	V960I	probably benign	Het
Sptbn2	T	C	19: 4,782,693 (GRCm39)	L543P	probably damaging	Het
Tll2	G	A	19: 41,108,667 (GRCm39)	R328C	probably damaging	Het
Unkl	A	G	17: 25,408,597 (GRCm39)	I54V	probably benign	Het
Wdr75	A	G	1: 45,838,222 (GRCm39)	T44A	probably benign	Het

Other mutations in Mid1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02590:Mid1	APN	X	168,710,019 (GRCm39)	missense	probably damaging	1.00
LCD18:Mid1	UTSW	X	168,788,560 (GRCm39)	unclassified	probably benign
R1317:Mid1	UTSW	X	168,769,090 (GRCm39)	missense	probably damaging	1.00
R1366:Mid1	UTSW	X	168,769,090 (GRCm39)	missense	probably damaging	1.00
R4452:Mid1	UTSW	X	168,710,421 (GRCm39)	missense	possibly damaging	0.62
R4678:Mid1	UTSW	X	168,768,044 (GRCm39)	missense	possibly damaging	0.79
R7100:Mid1	UTSW	X	168,768,073 (GRCm39)	missense	probably benign	0.43
R7554:Mid1	UTSW	X	168,769,010 (GRCm39)	missense	possibly damaging	0.93
R8510:Mid1	UTSW	X	168,768,019 (GRCm39)	missense	probably benign	0.03
R8979:Mid1	UTSW	X	168,768,009 (GRCm39)	missense	probably benign
R8979:Mid1	UTSW	X	168,768,003 (GRCm39)	missense	probably benign
R9322:Mid1	UTSW	X	168,768,003 (GRCm39)	missense	probably benign
R9650:Mid1	UTSW	X	168,768,003 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTGTGTAACTCGGCGGACAGC -3'
(R):5'- ACCCTGAGTGACCATGTGAGGC -3'

Sequencing Primer
(F):5'- ATCTTCACGGTGAAGGCCAT -3'
(R):5'- TGTGAGACATGGGGATGACTG -3'

Posted On

2014-10-01