Incidental Mutation 'E0354:1500011B03Rik'
List |< first << previous [record 23 of 18188] next >> last >|
ID233293
Institutional Source Beutler Lab
Gene Symbol 1500011B03Rik
Ensembl Gene ENSMUSG00000072694
Gene NameRIKEN cDNA 1500011B03 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #E0354 (G1)
Quality Score117
Status Not validated
Chromosome5
Chromosomal Location114808196-114813976 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 114813180 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 53 (N53K)
Ref Sequence ENSEMBL: ENSMUSP00000055114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061251] [ENSMUST00000112160] [ENSMUST00000140374]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061251
AA Change: N53K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000055114
Gene: ENSMUSG00000072694
AA Change: N53K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112160
SMART Domains Protein: ENSMUSP00000107786
Gene: ENSMUSG00000072694

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140374
SMART Domains Protein: ENSMUSP00000116625
Gene: ENSMUSG00000092252

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 10 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Dync1li2 T C 8: 104,425,467 D358G probably damaging Het
Gabra4 C G 5: 71,640,861 D208H probably damaging Het
Gata5 GCCC GCC 2: 180,333,965 probably null Het
Gdi2 T A 13: 3,561,939 probably null Het
Hdac5 TTCCTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTCCTC 11: 102,202,146 probably benign Het
Tlr3 A T 8: 45,400,820 D154E probably damaging Het
Trap1 G T 16: 4,065,288 P141Q probably benign Het
Trav8d-2 T A 14: 53,042,594 probably benign Het
Trim9 G A 12: 70,272,459 P412S probably benign Het
Zfp827 A G 8: 79,136,577 D763G probably damaging Het
Other mutations in 1500011B03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1513:1500011B03Rik UTSW 5 114809273 nonsense probably null
R4243:1500011B03Rik UTSW 5 114813794 missense possibly damaging 0.66
R4553:1500011B03Rik UTSW 5 114813193 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAAGCAGCTTCCTGAGGACC -3'
(R):5'- CGCCTCAGGGTTATTGTTAGT -3'

Sequencing Primer
(F):5'- TACTGCACATGGGCACATTG -3'
(R):5'- CGCCTCAGGGTTATTGTTAGTGAATC -3'
Posted On2014-10-01