Incidental Mutation 'E0374:Map1s'
ID233317
Institutional Source Beutler Lab
Gene Symbol Map1s
Ensembl Gene ENSMUSG00000019261
Gene Namemicrotubule-associated protein 1S
SynonymsBpy2ip1, Map8, VCY2IP1, 6430517J16Rik, Mtap1s
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #E0374 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70905932-70917529 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 70906017 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019405] [ENSMUST00000211910] [ENSMUST00000212227] [ENSMUST00000212511] [ENSMUST00000213001]
Predicted Effect unknown
Transcript: ENSMUST00000019405
AA Change: M5K
SMART Domains Protein: ENSMUSP00000019405
Gene: ENSMUSG00000019261
AA Change: M5K

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 125 137 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 208 225 N/A INTRINSIC
SCOP:d1e5da2 237 300 2e-3 SMART
Blast:Lactamase_B 244 475 1e-85 BLAST
low complexity region 536 550 N/A INTRINSIC
low complexity region 597 621 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 698 714 N/A INTRINSIC
low complexity region 715 734 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
low complexity region 774 801 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211880
Predicted Effect unknown
Transcript: ENSMUST00000211910
AA Change: M5K
Predicted Effect unknown
Transcript: ENSMUST00000212227
AA Change: M5K
Predicted Effect unknown
Transcript: ENSMUST00000212511
AA Change: M5K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212823
Predicted Effect probably benign
Transcript: ENSMUST00000213001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213083
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit defective biogenesis and degradation of autophagosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Antxr1 A G 6: 87,255,879 S234P probably benign Het
Bbox1 A G 2: 110,268,311 V307A probably damaging Het
Ccr6 T C 17: 8,256,452 V163A probably damaging Het
Cdkn3 C A 14: 46,767,173 probably null Het
Chst13 C A 6: 90,309,192 E263* probably null Het
Dctn1 T A 6: 83,194,174 C754S possibly damaging Het
Dlgap4 T G 2: 156,761,843 I185S probably damaging Het
Heca T A 10: 17,908,176 H443L probably damaging Het
Klkb1 C T 8: 45,289,091 M50I possibly damaging Het
Lamb1 A G 12: 31,287,930 Y414C probably damaging Het
Maff C A 15: 79,357,675 N97K probably damaging Het
Mfsd10 A T 5: 34,636,637 probably null Het
Nfam1 T G 15: 83,016,410 I124L probably benign Het
Omg T G 11: 79,502,949 I28L probably benign Het
Pfkm A T 15: 98,123,233 I311F probably damaging Het
Sap30 T A 8: 57,485,061 N174I probably damaging Het
Sdc1 T A 12: 8,789,424 N28K probably damaging Het
Trabd2b T G 4: 114,599,897 V337G probably damaging Het
Other mutations in Map1s
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Map1s APN 8 70906029 unclassified probably benign
IGL01012:Map1s APN 8 70913910 missense probably benign 0.00
IGL01729:Map1s APN 8 70913068 missense probably damaging 1.00
IGL03158:Map1s APN 8 70914734 missense probably damaging 0.97
R0026:Map1s UTSW 8 70914638 missense probably damaging 1.00
R0172:Map1s UTSW 8 70914968 missense probably benign 0.00
R0571:Map1s UTSW 8 70912907 missense probably damaging 1.00
R0666:Map1s UTSW 8 70914052 missense possibly damaging 0.88
R0904:Map1s UTSW 8 70914188 missense probably damaging 0.96
R1617:Map1s UTSW 8 70913451 missense probably damaging 1.00
R1834:Map1s UTSW 8 70916411 missense probably damaging 0.97
R2134:Map1s UTSW 8 70913882 missense probably benign 0.00
R2143:Map1s UTSW 8 70910964 missense probably damaging 1.00
R3413:Map1s UTSW 8 70912519 missense probably damaging 0.99
R3870:Map1s UTSW 8 70917101 missense possibly damaging 0.82
R5555:Map1s UTSW 8 70917107 missense probably damaging 0.97
R5784:Map1s UTSW 8 70914358 missense probably damaging 1.00
R6630:Map1s UTSW 8 70913798 missense probably damaging 1.00
Z1088:Map1s UTSW 8 70916449 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TAGTACACAGCCAGTCTCAGTC -3'
(R):5'- TATGCCCGTCTGGATCGTAG -3'

Sequencing Primer
(F):5'- GTCCTCTTCGGGCTCCCAAAG -3'
(R):5'- AACGTTGCGTCCAGGGAC -3'
Posted On2014-10-01