Mutagenetix > Incidental Mutation

Incidental Mutation 'E0374:Ccr6'

233329

Institutional Source

Beutler Lab

Gene Symbol

Ccr6

Ensembl Gene

ENSMUSG00000040899

Gene Name

C-C motif chemokine receptor 6

Synonyms

Cmkbr6

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

E0374 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8454875-8475973 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 8475284 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 163 (V163A)

Ref Sequence

ENSEMBL: ENSMUSP00000156324 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097418] [ENSMUST00000164411] [ENSMUST00000166348] [ENSMUST00000167956] [ENSMUST00000177568] [ENSMUST00000180103] [ENSMUST00000231340] [ENSMUST00000231545]

AlphaFold

O54689

Predicted Effect

probably damaging
Transcript: ENSMUST00000097418
AA Change: V163A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095029
Gene: ENSMUSG00000040899
AA Change: V163A

Domain	Start	End	E-Value	Type
Pfam:7tm_1	55	308	6.5e-55	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000164411
AA Change: V163A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131153
Gene: ENSMUSG00000040899
AA Change: V163A

Domain	Start	End	E-Value	Type
Pfam:7tm_1	55	308	6.5e-55	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000166348
AA Change: V163A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128559
Gene: ENSMUSG00000040899
AA Change: V163A

Domain	Start	End	E-Value	Type
Pfam:7tm_1	55	308	6.5e-55	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000167956
AA Change: V163A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128529
Gene: ENSMUSG00000040899
AA Change: V163A

Domain	Start	End	E-Value	Type
Pfam:7tm_1	55	308	6.5e-55	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000177568
AA Change: V163A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000137249
Gene: ENSMUSG00000040899
AA Change: V163A

Domain	Start	End	E-Value	Type
Pfam:7tm_1	55	308	8.9e-50	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000180103
AA Change: V163A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135945
Gene: ENSMUSG00000040899
AA Change: V163A

Domain	Start	End	E-Value	Type
Pfam:7tm_1	55	308	6.5e-55	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000231340

Predicted Effect

probably damaging
Transcript: ENSMUST00000231545
AA Change: V163A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232412

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The gene is preferentially expressed by immature dendritic cells and memory T cells. The ligand of this receptor is macrophage inflammatory protein 3 alpha (MIP-3 alpha). This receptor has been shown to be important for B-lineage maturation and antigen-driven B-cell differentiation, and it may regulate the migration and recruitment of dentritic and T cells during inflammatory and immunological responses. Alternatively spliced transcript variants that encode the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have decreased inflammatory responses, aberrant trafficking of lymphocytes and dendritic cells, and decreased expression of many inflammatory mediators. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Antxr1	A	G	6: 87,232,861 (GRCm39)	S234P	probably benign	Het
Bbox1	A	G	2: 110,098,656 (GRCm39)	V307A	probably damaging	Het
Cdkn3	C	A	14: 47,004,630 (GRCm39)		probably null	Het
Chst13	C	A	6: 90,286,174 (GRCm39)	E263*	probably null	Het
Dctn1	T	A	6: 83,171,156 (GRCm39)	C754S	possibly damaging	Het
Dlgap4	T	G	2: 156,603,763 (GRCm39)	I185S	probably damaging	Het
Heca	T	A	10: 17,783,924 (GRCm39)	H443L	probably damaging	Het
Klkb1	C	T	8: 45,742,128 (GRCm39)	M50I	possibly damaging	Het
Lamb1	A	G	12: 31,337,929 (GRCm39)	Y414C	probably damaging	Het
Maff	C	A	15: 79,241,875 (GRCm39)	N97K	probably damaging	Het
Map1s	T	A	8: 71,358,661 (GRCm39)		probably benign	Het
Mfsd10	A	T	5: 34,793,981 (GRCm39)		probably null	Het
Nfam1	T	G	15: 82,900,611 (GRCm39)	I124L	probably benign	Het
Omg	T	G	11: 79,393,775 (GRCm39)	I28L	probably benign	Het
Pfkm	A	T	15: 98,021,114 (GRCm39)	I311F	probably damaging	Het
Sap30	T	A	8: 57,938,095 (GRCm39)	N174I	probably damaging	Het
Sdc1	T	A	12: 8,839,424 (GRCm39)	N28K	probably damaging	Het
Trabd2b	T	G	4: 114,457,094 (GRCm39)	V337G	probably damaging	Het

Other mutations in Ccr6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00927:Ccr6	APN	17	8,474,825 (GRCm39)	missense	probably benign	0.07
IGL02227:Ccr6	APN	17	8,475,284 (GRCm39)	missense	probably damaging	1.00
IGL02339:Ccr6	APN	17	8,475,085 (GRCm39)	missense	probably benign	0.01
R0021:Ccr6	UTSW	17	8,475,598 (GRCm39)	missense	possibly damaging	0.46
R0976:Ccr6	UTSW	17	8,475,254 (GRCm39)	missense	probably damaging	1.00
R0980:Ccr6	UTSW	17	8,474,846 (GRCm39)	missense	probably benign	0.00
R1141:Ccr6	UTSW	17	8,474,834 (GRCm39)	missense	probably damaging	1.00
R1674:Ccr6	UTSW	17	8,475,049 (GRCm39)	missense	probably damaging	0.99
R2117:Ccr6	UTSW	17	8,474,914 (GRCm39)	missense	possibly damaging	0.75
R2176:Ccr6	UTSW	17	8,475,073 (GRCm39)	missense	probably damaging	0.99
R4736:Ccr6	UTSW	17	8,474,896 (GRCm39)	nonsense	probably null
R5050:Ccr6	UTSW	17	8,474,936 (GRCm39)	missense	probably damaging	1.00
R5786:Ccr6	UTSW	17	8,475,244 (GRCm39)	missense	probably damaging	0.99
R6138:Ccr6	UTSW	17	8,475,214 (GRCm39)	missense	probably damaging	1.00
R6856:Ccr6	UTSW	17	8,474,881 (GRCm39)	missense	probably benign	0.08
R6950:Ccr6	UTSW	17	8,475,898 (GRCm39)	makesense	probably null
R7102:Ccr6	UTSW	17	8,475,019 (GRCm39)	missense	probably benign	0.15
R7206:Ccr6	UTSW	17	8,475,781 (GRCm39)	missense	probably benign
R7223:Ccr6	UTSW	17	8,474,972 (GRCm39)	missense	probably damaging	1.00
R7323:Ccr6	UTSW	17	8,475,611 (GRCm39)	missense	possibly damaging	0.88
R7737:Ccr6	UTSW	17	8,463,926 (GRCm39)	start gained	probably benign
R7974:Ccr6	UTSW	17	8,475,056 (GRCm39)	missense	probably damaging	1.00
R8145:Ccr6	UTSW	17	8,474,945 (GRCm39)	missense	probably benign	0.16
R8699:Ccr6	UTSW	17	8,475,398 (GRCm39)	missense	probably benign	0.20
R8738:Ccr6	UTSW	17	8,475,394 (GRCm39)	missense	probably damaging	0.98
R8983:Ccr6	UTSW	17	8,474,878 (GRCm39)	missense	probably damaging	1.00
R9242:Ccr6	UTSW	17	8,474,965 (GRCm39)	missense	probably benign	0.01
R9689:Ccr6	UTSW	17	8,475,821 (GRCm39)	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- CTTGGGTTTTCAGCGATGCAC -3'
(R):5'- CCTGCACCAAGGTCTTGATAATG -3'

Sequencing Primer
(F):5'- TCAGCGATGCACTGTGTAAACTG -3'
(R):5'- TGCACCAAGGTCTTGATAATGAACAG -3'

Posted On

2014-10-01