Incidental Mutation 'R2132:Acacb'
List |< first << previous [record 49 of 1259] next >> last >|
ID233377
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Nameacetyl-Coenzyme A carboxylase beta
SynonymsAcc2, Accb
MMRRC Submission 040135-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2132 (G1)
Quality Score147
Status Validated
Chromosome5
Chromosomal Location114146535-114250761 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TGGGG to TGGG at 114209767 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
Predicted Effect probably null
Transcript: ENSMUST00000031583
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102582
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143276
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 94% (117/124)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 122 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,964,476 probably benign Het
4930562C15Rik A C 16: 4,835,971 Q128P unknown Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
9130019O22Rik T C 7: 127,386,935 D8G probably benign Het
9530053A07Rik C T 7: 28,155,474 P1842S probably damaging Het
Abcc3 T A 11: 94,367,600 K473M probably benign Het
Adgrg7 C A 16: 56,767,918 A199S probably damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Ap2b1 T A 11: 83,324,761 probably benign Het
Atat1 A G 17: 35,909,439 S54P probably damaging Het
Atp13a2 T A 4: 141,005,016 M864K probably damaging Het
B3gnt3 G A 8: 71,693,327 T186M probably damaging Het
Cars C A 7: 143,592,474 R71M probably damaging Het
Ccdc157 A T 11: 4,150,004 V116E probably damaging Het
Ccdc85a G A 11: 28,434,151 T408I probably benign Het
Celf1 G T 2: 91,010,446 G353W probably damaging Het
Celsr1 T A 15: 86,031,967 I602F possibly damaging Het
Cenpb C T 2: 131,179,306 V191M probably damaging Het
Cenpn G A 8: 116,934,797 probably null Het
Cfap65 A C 1: 74,907,691 C1287G probably damaging Het
Cmya5 G A 13: 93,069,383 T3326I probably damaging Het
Cnn3 A T 3: 121,451,935 E100V probably damaging Het
Col4a4 G A 1: 82,497,860 R583C unknown Het
Commd7 A C 2: 153,621,666 probably benign Het
Csmd3 T C 15: 48,457,503 T304A probably benign Het
Cyp4a14 A T 4: 115,491,391 S325R probably damaging Het
D730048I06Rik T G 9: 35,789,743 probably benign Het
Dclk2 T C 3: 86,920,046 N42S probably benign Het
Dmrta1 A T 4: 89,688,709 Q134L probably damaging Het
Dnaaf3 T A 7: 4,523,801 I426L probably benign Het
Dnah17 G A 11: 118,033,747 L3999F probably damaging Het
Dock6 A G 9: 21,846,518 S97P probably benign Het
Dsg1a T A 18: 20,340,797 S976T probably damaging Het
Dstyk T A 1: 132,449,484 M29K probably null Het
Eif3i A T 4: 129,596,926 H18Q probably benign Het
Epm2a A G 10: 11,343,682 E71G probably benign Het
Eps15l1 A T 8: 72,386,868 V260D probably benign Het
Faf1 A G 4: 109,710,845 N34S probably damaging Het
Fat3 A G 9: 16,246,719 probably null Het
Fbxw10 T A 11: 62,859,857 I422N probably damaging Het
Fkbp15 C A 4: 62,327,899 G431W probably damaging Het
Flnb A C 14: 7,873,376 D224A probably benign Het
Flnc G A 6: 29,443,676 V566M probably damaging Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gli3 T A 13: 15,725,549 S1174T possibly damaging Het
Glmn A T 5: 107,578,455 V93E probably damaging Het
Glrx2 T C 1: 143,745,104 S74P possibly damaging Het
Gm13212 T A 4: 145,624,233 probably benign Het
Gm5422 G A 10: 31,248,933 noncoding transcript Het
Gpi1 T C 7: 34,205,914 K362E probably damaging Het
Gtpbp2 T C 17: 46,161,202 M21T probably benign Het
Gxylt1 A G 15: 93,244,970 *405R probably null Het
Heyl T C 4: 123,246,083 V145A probably damaging Het
Hhipl1 A C 12: 108,311,690 E92D probably damaging Het
Ifi207 A G 1: 173,729,771 F467S possibly damaging Het
Igf2r A T 17: 12,722,208 I462N probably benign Het
Inpp5b A T 4: 124,785,168 probably benign Het
Kansl2 A G 15: 98,529,397 I201T probably damaging Het
Kcnh8 T C 17: 52,893,933 V465A probably damaging Het
Kcnu1 T A 8: 25,851,900 I91N probably damaging Het
Kif5c T A 2: 49,758,805 probably benign Het
Klrc3 T A 6: 129,641,538 Y94F probably benign Het
Lgals3bp T A 11: 118,393,287 T489S probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Magi1 T C 6: 93,697,274 E951G probably damaging Het
Mcm7 T C 5: 138,169,102 Q86R probably damaging Het
Med12l G T 3: 59,265,282 probably null Het
Morc2a A G 11: 3,679,787 E402G possibly damaging Het
Mphosph8 T C 14: 56,678,704 C486R probably benign Het
Mpo A G 11: 87,797,361 D282G possibly damaging Het
Mtcl1 G T 17: 66,343,623 H1616N probably benign Het
Myh10 A G 11: 68,807,289 probably benign Het
Myh8 A G 11: 67,292,876 E777G probably damaging Het
Nid1 A G 13: 13,509,486 H1186R probably benign Het
Nppb T A 4: 147,985,997 S8T probably benign Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Ntrk3 G A 7: 78,477,935 probably benign Het
Olfr1039 A G 2: 86,131,261 V134A possibly damaging Het
Olfr1451 T A 19: 12,999,038 D17E probably benign Het
Olfr308 C T 7: 86,321,479 V158M possibly damaging Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr356 A G 2: 36,937,692 N191S probably benign Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Pard6g T C 18: 80,117,308 V212A probably damaging Het
Pdlim4 A G 11: 54,063,737 L48S possibly damaging Het
Phactr3 T C 2: 178,283,966 F345L probably benign Het
Plcb1 T A 2: 135,325,667 Y460* probably null Het
Prcp T A 7: 92,901,280 V95D probably benign Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Ror1 A G 4: 100,410,025 N308D probably benign Het
Sdccag8 C A 1: 176,955,889 Q655K probably damaging Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Skap1 T C 11: 96,464,733 I10T possibly damaging Het
Slc9a4 T G 1: 40,607,741 probably null Het
Smad2 T A 18: 76,288,084 C161* probably null Het
Spata31d1a G T 13: 59,701,043 D1090E probably damaging Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Tdrd6 T C 17: 43,624,833 T1775A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Terf1 A G 1: 15,805,685 E3G probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tnfrsf26 C T 7: 143,617,840 probably null Het
Tor1aip1 A C 1: 156,007,562 M180R probably damaging Het
Trabd2b A T 4: 114,610,008 Q478L probably benign Het
Trim41 C A 11: 48,807,592 G516W probably damaging Het
Ttc30b G T 2: 75,936,785 H541Q probably damaging Het
Ttc39a A G 4: 109,442,706 Y464C probably damaging Het
Unc5a A G 13: 54,991,083 S92G probably damaging Het
Unc5d A C 8: 28,875,529 S143A possibly damaging Het
Usp34 A T 11: 23,464,556 H2833L possibly damaging Het
Wdr17 T G 8: 54,672,506 K446N probably damaging Het
Xirp2 A T 2: 67,508,048 Q211L possibly damaging Het
Xkr7 G A 2: 153,052,896 R256Q probably benign Het
Zfp236 T C 18: 82,621,304 M1225V probably benign Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp758 A G 17: 22,375,970 H479R probably damaging Het
Zfp827 A G 8: 79,185,721 N284S possibly damaging Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114200289 missense probably damaging 1.00
IGL01291:Acacb APN 5 114225870 missense probably benign 0.03
IGL01301:Acacb APN 5 114246498 missense probably benign
IGL01633:Acacb APN 5 114218858 splice site probably benign
IGL01736:Acacb APN 5 114188442 missense possibly damaging 0.96
IGL01782:Acacb APN 5 114200520 missense probably damaging 1.00
IGL01924:Acacb APN 5 114223986 splice site probably benign
IGL01933:Acacb APN 5 114184190 splice site probably benign
IGL02028:Acacb APN 5 114166015 missense probably damaging 1.00
IGL02045:Acacb APN 5 114240660 missense possibly damaging 0.95
IGL02346:Acacb APN 5 114238699 missense probably damaging 1.00
IGL02421:Acacb APN 5 114223878 missense probably benign 0.00
IGL02445:Acacb APN 5 114245137 missense probably damaging 1.00
IGL02491:Acacb APN 5 114192105 missense probably damaging 1.00
IGL02598:Acacb APN 5 114246037 missense probably damaging 1.00
IGL02700:Acacb APN 5 114218881 missense probably damaging 1.00
IGL02730:Acacb APN 5 114166149 splice site probably benign
IGL03110:Acacb APN 5 114195234 missense probably damaging 0.96
IGL03125:Acacb APN 5 114204805 missense possibly damaging 0.49
IGL03263:Acacb APN 5 114213693 missense probably damaging 1.00
IGL03324:Acacb APN 5 114225854 nonsense probably null
ANU05:Acacb UTSW 5 114225870 missense probably benign 0.03
ANU18:Acacb UTSW 5 114246498 missense probably benign
I0000:Acacb UTSW 5 114238655 missense probably damaging 0.99
R0001:Acacb UTSW 5 114204833 splice site probably benign
R0219:Acacb UTSW 5 114232944 missense possibly damaging 0.79
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0278:Acacb UTSW 5 114233259 nonsense probably null
R0607:Acacb UTSW 5 114200301 missense probably damaging 1.00
R0964:Acacb UTSW 5 114229752 missense possibly damaging 0.64
R1116:Acacb UTSW 5 114210956 missense probably damaging 1.00
R1196:Acacb UTSW 5 114245092 missense probably benign 0.00
R1204:Acacb UTSW 5 114190153 missense probably damaging 1.00
R1387:Acacb UTSW 5 114200512 missense probably benign
R1415:Acacb UTSW 5 114165921 missense probably benign
R1475:Acacb UTSW 5 114195252 missense possibly damaging 0.87
R1497:Acacb UTSW 5 114196807 missense probably damaging 1.00
R1520:Acacb UTSW 5 114201940 missense possibly damaging 0.67
R1591:Acacb UTSW 5 114203423 missense possibly damaging 0.87
R1644:Acacb UTSW 5 114195285 missense probably damaging 1.00
R1732:Acacb UTSW 5 114190087 missense possibly damaging 0.63
R1783:Acacb UTSW 5 114209767 frame shift probably null
R1784:Acacb UTSW 5 114209767 frame shift probably null
R1834:Acacb UTSW 5 114235475 missense probably damaging 1.00
R1858:Acacb UTSW 5 114196709 missense probably benign 0.13
R1886:Acacb UTSW 5 114218959 missense probably damaging 1.00
R1901:Acacb UTSW 5 114165734 nonsense probably null
R1902:Acacb UTSW 5 114165734 nonsense probably null
R1903:Acacb UTSW 5 114165734 nonsense probably null
R1924:Acacb UTSW 5 114230720 missense possibly damaging 0.67
R1934:Acacb UTSW 5 114198282 missense probably benign 0.27
R2051:Acacb UTSW 5 114245890 missense probably damaging 1.00
R2133:Acacb UTSW 5 114209767 frame shift probably null
R2260:Acacb UTSW 5 114216917 missense probably damaging 0.99
R2967:Acacb UTSW 5 114166070 missense possibly damaging 0.81
R3421:Acacb UTSW 5 114212636 splice site probably null
R3729:Acacb UTSW 5 114207348 missense probably damaging 0.99
R4206:Acacb UTSW 5 114213651 missense probably benign
R4245:Acacb UTSW 5 114230784 missense probably damaging 0.97
R4386:Acacb UTSW 5 114241921 critical splice acceptor site probably null
R4439:Acacb UTSW 5 114246496 missense possibly damaging 0.50
R4577:Acacb UTSW 5 114226831 missense probably damaging 1.00
R4658:Acacb UTSW 5 114200564 missense probably damaging 0.96
R4688:Acacb UTSW 5 114204763 missense probably benign 0.01
R4720:Acacb UTSW 5 114229914 missense possibly damaging 0.73
R4898:Acacb UTSW 5 114232938 missense probably benign 0.04
R5044:Acacb UTSW 5 114166027 missense probably benign 0.03
R5070:Acacb UTSW 5 114246028 missense possibly damaging 0.46
R5294:Acacb UTSW 5 114241952 missense probably damaging 1.00
R5350:Acacb UTSW 5 114244551 missense probably damaging 1.00
R5401:Acacb UTSW 5 114209853 missense possibly damaging 0.80
R5531:Acacb UTSW 5 114204706 missense possibly damaging 0.92
R5542:Acacb UTSW 5 114195737 missense probably damaging 1.00
R5751:Acacb UTSW 5 114230832 missense possibly damaging 0.79
R5821:Acacb UTSW 5 114184106 missense possibly damaging 0.69
R5893:Acacb UTSW 5 114229851 missense probably benign 0.01
R5911:Acacb UTSW 5 114232890 missense probably damaging 0.97
R5944:Acacb UTSW 5 114245980 missense probably damaging 1.00
R5973:Acacb UTSW 5 114226867 missense probably damaging 1.00
R6027:Acacb UTSW 5 114165600 missense probably benign 0.43
R6103:Acacb UTSW 5 114245881 missense probably damaging 1.00
R6139:Acacb UTSW 5 114212652 missense probably damaging 1.00
R6292:Acacb UTSW 5 114200251 missense probably damaging 1.00
R6368:Acacb UTSW 5 114216823 missense probably damaging 0.98
R6429:Acacb UTSW 5 114228591 missense probably damaging 1.00
R6942:Acacb UTSW 5 114191963 critical splice donor site probably null
V1662:Acacb UTSW 5 114238708 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGTTTCAAGTGAGTAGGTCG -3'
(R):5'- CTTTCTGTGACAATGGCGCC -3'

Sequencing Primer
(F):5'- GTCGGGTCAGTGCTTTCTCC -3'
(R):5'- AATGGCGCCCCACACAG -3'
Posted On2014-10-01