Incidental Mutation 'R2134:Fxr1'
ID233616
Institutional Source Beutler Lab
Gene Symbol Fxr1
Ensembl Gene ENSMUSG00000027680
Gene Namefragile X mental retardation gene 1, autosomal homolog
Synonyms9530073J07Rik, Fxr1p, Fxr1h, 1110050J02Rik
MMRRC Submission 040137-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2134 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location34019943-34070322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34058047 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 367 (E367D)
Ref Sequence ENSEMBL: ENSMUSP00000143392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001620] [ENSMUST00000011029] [ENSMUST00000167354] [ENSMUST00000197694] [ENSMUST00000198051] [ENSMUST00000200086] [ENSMUST00000200392]
Predicted Effect probably damaging
Transcript: ENSMUST00000001620
AA Change: E367D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001620
Gene: ENSMUSG00000027680
AA Change: E367D

DomainStartEndE-ValueType
Pfam:Agenet 2 55 4.4e-7 PFAM
Pfam:Agenet 62 120 7.1e-10 PFAM
KH 217 284 3.57e-4 SMART
KH 286 356 1.22e-2 SMART
low complexity region 404 421 N/A INTRINSIC
Pfam:FXR_C1 489 564 1.9e-41 PFAM
low complexity region 572 582 N/A INTRINSIC
Pfam:FXR_C3 610 676 1.3e-29 PFAM
Predicted Effect silent
Transcript: ENSMUST00000011029
SMART Domains Protein: ENSMUSP00000011029
Gene: ENSMUSG00000027679

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
DnaJ 61 101 1.31e-1 SMART
low complexity region 106 124 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167354
AA Change: E282D

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130216
Gene: ENSMUSG00000027680
AA Change: E282D

DomainStartEndE-ValueType
Pfam:Agenet 59 120 3.3e-14 PFAM
KH 217 284 3.57e-4 SMART
KH 286 356 1.22e-2 SMART
Pfam:FXR1P_C 361 380 4.2e-9 PFAM
Pfam:FXR1P_C 379 486 1.5e-41 PFAM
low complexity region 502 510 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197694
AA Change: E367D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142441
Gene: ENSMUSG00000027680
AA Change: E367D

DomainStartEndE-ValueType
Pfam:Agenet 59 120 3.9e-14 PFAM
KH 217 284 3.57e-4 SMART
KH 286 356 1.22e-2 SMART
Pfam:FXR1P_C 361 380 5e-9 PFAM
Pfam:FXR1P_C 379 486 1.8e-41 PFAM
low complexity region 502 510 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198051
AA Change: E367D

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142847
Gene: ENSMUSG00000027680
AA Change: E367D

DomainStartEndE-ValueType
Pfam:Agenet 59 120 1.2e-11 PFAM
KH 217 284 2.2e-6 SMART
KH 286 356 7.5e-5 SMART
Pfam:FXR1P_C 361 515 1.6e-64 PFAM
low complexity region 531 539 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198616
Predicted Effect probably benign
Transcript: ENSMUST00000200086
SMART Domains Protein: ENSMUSP00000143562
Gene: ENSMUSG00000027680

DomainStartEndE-ValueType
PDB:3O8V|A 2 40 1e-17 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000200392
AA Change: E367D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143392
Gene: ENSMUSG00000027680
AA Change: E367D

DomainStartEndE-ValueType
Pfam:Agenet 59 120 3.3e-14 PFAM
KH 217 284 3.57e-4 SMART
KH 286 356 1.22e-2 SMART
Pfam:FXR1P_C 361 380 4.2e-9 PFAM
Pfam:FXR1P_C 379 486 1.5e-41 PFAM
low complexity region 502 510 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA binding protein that interacts with the functionally-similar proteins FMR1 and FXR2. These proteins shuttle between the nucleus and cytoplasm and associate with polyribosomes, predominantly with the 60S ribosomal subunit. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality with impaired muscle development. Mice homozygous for a hypomorphic allele display a reduced life span with impaired muscle development, growth retardation, and reduced grip strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,030,917 V1437E probably null Het
Adam12 G A 7: 134,012,288 R80* probably null Het
Adgrb3 G T 1: 25,093,957 F479L probably damaging Het
Atf7ip T A 6: 136,605,487 V1165E possibly damaging Het
Atm C T 9: 53,467,964 probably null Het
Atp11c A G X: 60,276,783 Y593H probably damaging Het
Btnl1 A G 17: 34,385,634 D463G possibly damaging Het
Cdc34b T G 11: 94,742,426 W151G probably damaging Het
Cdkal1 A G 13: 29,354,677 S500P possibly damaging Het
Cenpf T C 1: 189,658,642 N998D probably benign Het
Ces2e T A 8: 104,932,539 probably null Het
Chd7 A G 4: 8,753,147 Q548R probably damaging Het
Chfr T A 5: 110,144,761 probably null Het
Clu A G 14: 65,974,841 probably null Het
Cntnap5c A G 17: 58,407,722 D1235G probably damaging Het
Col6a4 T C 9: 106,066,661 S1205G probably benign Het
Ddx47 G T 6: 135,015,350 E113* probably null Het
Dock4 A G 12: 40,745,668 Y828C probably benign Het
Dync1h1 T A 12: 110,656,631 N3553K possibly damaging Het
Egflam C T 15: 7,234,279 C730Y probably damaging Het
Fam83b T C 9: 76,491,016 Y935C probably damaging Het
Fam83g A G 11: 61,703,684 I681M probably benign Het
Fastk T C 5: 24,445,141 R3G probably damaging Het
Gatb A G 3: 85,611,370 D261G probably damaging Het
Gm5617 T C 9: 48,495,817 S84P possibly damaging Het
Gm6614 T C 6: 141,980,978 I541V probably damaging Het
Hecw1 C T 13: 14,377,700 E104K probably damaging Het
Il31ra T C 13: 112,543,888 K265R possibly damaging Het
Khsrp GTCATT GT 17: 57,024,410 probably null Het
Lrp2 T A 2: 69,511,067 D923V probably damaging Het
Ltn1 A G 16: 87,382,713 L1520P probably damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Map1s T G 8: 70,913,882 V477G probably benign Het
Mical1 T C 10: 41,482,712 L542P probably damaging Het
Mycbp2 T C 14: 103,208,893 Y1800C probably damaging Het
Mylk A T 16: 34,986,476 D1697V probably benign Het
Nlrp1a A T 11: 71,124,188 F79I probably benign Het
Olfr653 T C 7: 104,579,641 probably benign Het
Pde9a A G 17: 31,386,310 Y6C probably damaging Het
Plxnd1 A T 6: 115,957,548 I1808N probably damaging Het
Ppp1r13b T A 12: 111,833,733 T537S probably benign Het
Ppp2r2a A G 14: 67,016,475 F415L possibly damaging Het
Rabgap1 C T 2: 37,563,487 R976* probably null Het
Rbfox3 T C 11: 118,497,016 H195R probably damaging Het
Ripk4 A T 16: 97,743,733 D571E probably damaging Het
Sdhaf4 T A 1: 24,005,553 R16S probably benign Het
Slc17a1 G T 13: 23,875,675 G130* probably null Het
Slc6a1 G T 6: 114,302,016 A23S probably benign Het
Soga3 T A 10: 29,196,399 Y562* probably null Het
Spock1 T A 13: 57,436,139 Q321L probably damaging Het
Syne2 A G 12: 75,952,786 I2318V probably damaging Het
Terf2ip T C 8: 112,011,639 V53A possibly damaging Het
Thrb T C 14: 18,033,487 F403L probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Uqcrfs1 T C 13: 30,540,804 K251R probably benign Het
Vmn2r111 T C 17: 22,573,104 E57G possibly damaging Het
Vmn2r114 T A 17: 23,291,763 Y581F probably damaging Het
Vps13d A G 4: 145,148,339 V1866A probably benign Het
Washc5 A T 15: 59,369,234 F84Y probably damaging Het
Yars T A 4: 129,197,199 Y28* probably null Het
Zfp638 A G 6: 83,928,982 Y43C probably damaging Het
Zfp750 T A 11: 121,513,932 H39L probably damaging Het
Zfr2 C A 10: 81,242,901 S322R probably damaging Het
Zzef1 A G 11: 72,880,624 D1644G probably benign Het
Other mutations in Fxr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Fxr1 APN 3 34047627 splice site probably benign
IGL01598:Fxr1 APN 3 34064232 missense possibly damaging 0.61
pueblo UTSW 3 34064232 missense possibly damaging 0.61
R1294:Fxr1 UTSW 3 34047052 missense probably benign 0.00
R2405:Fxr1 UTSW 3 34061854 missense probably damaging 1.00
R3023:Fxr1 UTSW 3 34064224 missense probably damaging 1.00
R3055:Fxr1 UTSW 3 34049184 missense probably damaging 1.00
R3056:Fxr1 UTSW 3 34049184 missense probably damaging 1.00
R4009:Fxr1 UTSW 3 34065022 missense probably benign 0.31
R4010:Fxr1 UTSW 3 34065022 missense probably benign 0.31
R4706:Fxr1 UTSW 3 34064129 missense probably damaging 0.99
R4721:Fxr1 UTSW 3 34064232 missense possibly damaging 0.61
R4877:Fxr1 UTSW 3 34047698 missense probably damaging 0.99
R5583:Fxr1 UTSW 3 34068976 missense probably benign 0.18
R6280:Fxr1 UTSW 3 34046252 intron probably benign
R6801:Fxr1 UTSW 3 34054303 missense possibly damaging 0.65
R7203:Fxr1 UTSW 3 34046540 missense possibly damaging 0.76
R7422:Fxr1 UTSW 3 34049220 missense probably damaging 1.00
X0067:Fxr1 UTSW 3 34046044 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TTCCAGCTCTAGGCCAAAAC -3'
(R):5'- TTTCAGCCAAAATGTATGCAGC -3'

Sequencing Primer
(F):5'- GCTCTAGGCCAAAACACACAAATC -3'
(R):5'- TGTATGCAGCATCTAAACTAGAACC -3'
Posted On2014-10-01