Incidental Mutation 'R2134:Fastk'
ID233622
Institutional Source Beutler Lab
Gene Symbol Fastk
Ensembl Gene ENSMUSG00000028959
Gene NameFas-activated serine/threonine kinase
Synonyms
MMRRC Submission 040137-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2134 (G1)
Quality Score145
Status Not validated
Chromosome5
Chromosomal Location24438440-24445287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24445141 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 3 (R3G)
Ref Sequence ENSEMBL: ENSMUSP00000110695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030799] [ENSMUST00000030800] [ENSMUST00000080067] [ENSMUST00000115033] [ENSMUST00000115036] [ENSMUST00000115041] [ENSMUST00000115043] [ENSMUST00000115047] [ENSMUST00000115049] [ENSMUST00000123167] [ENSMUST00000127194] [ENSMUST00000144389]
Predicted Effect probably benign
Transcript: ENSMUST00000030799
SMART Domains Protein: ENSMUSP00000030799
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
UBQ 102 171 4.58e-4 SMART
transmembrane domain 190 212 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000030800
AA Change: R3G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030800
Gene: ENSMUSG00000028959
AA Change: R3G

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
Pfam:FAST_1 274 340 7.4e-18 PFAM
Pfam:FAST_2 351 440 5e-20 PFAM
RAP 475 532 3.04e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080067
SMART Domains Protein: ENSMUSP00000078972
Gene: ENSMUSG00000028962

DomainStartEndE-ValueType
low complexity region 93 110 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
low complexity region 138 151 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 296 313 N/A INTRINSIC
Pfam:Band_3_cyto 348 616 4.7e-111 PFAM
Pfam:HCO3_cotransp 671 1165 1.7e-217 PFAM
transmembrane domain 1183 1200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115033
SMART Domains Protein: ENSMUSP00000110685
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
UBQ 102 171 4.58e-4 SMART
transmembrane domain 190 212 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115036
SMART Domains Protein: ENSMUSP00000110688
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
transmembrane domain 26 45 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
UBQ 117 186 4.58e-4 SMART
low complexity region 190 206 N/A INTRINSIC
transmembrane domain 207 229 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115041
AA Change: R3G

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110693
Gene: ENSMUSG00000028959
AA Change: R3G

DomainStartEndE-ValueType
low complexity region 43 57 N/A INTRINSIC
low complexity region 101 112 N/A INTRINSIC
Pfam:FAST_1 136 204 5.4e-24 PFAM
Pfam:FAST_2 212 303 4.7e-26 PFAM
RAP 338 395 3.04e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115043
AA Change: R3G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110695
Gene: ENSMUSG00000028959
AA Change: R3G

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
Pfam:FAST_1 273 341 7.6e-24 PFAM
Pfam:FAST_2 349 440 6.9e-26 PFAM
Pfam:RAP 475 513 1.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115047
SMART Domains Protein: ENSMUSP00000110699
Gene: ENSMUSG00000028962

DomainStartEndE-ValueType
low complexity region 79 96 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
low complexity region 124 137 N/A INTRINSIC
low complexity region 155 164 N/A INTRINSIC
low complexity region 186 202 N/A INTRINSIC
low complexity region 282 299 N/A INTRINSIC
Pfam:Band_3_cyto 334 602 7.2e-108 PFAM
Pfam:HCO3_cotransp 656 1151 1e-244 PFAM
transmembrane domain 1169 1186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115049
SMART Domains Protein: ENSMUSP00000110701
Gene: ENSMUSG00000028962

DomainStartEndE-ValueType
low complexity region 84 101 N/A INTRINSIC
low complexity region 103 126 N/A INTRINSIC
low complexity region 129 142 N/A INTRINSIC
low complexity region 160 169 N/A INTRINSIC
low complexity region 191 207 N/A INTRINSIC
low complexity region 287 304 N/A INTRINSIC
Pfam:Band_3_cyto 339 607 7.3e-108 PFAM
Pfam:HCO3_cotransp 661 1156 1e-244 PFAM
transmembrane domain 1174 1191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123144
Predicted Effect probably benign
Transcript: ENSMUST00000123167
SMART Domains Protein: ENSMUSP00000122487
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
Blast:UBQ 102 122 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127194
SMART Domains Protein: ENSMUSP00000123173
Gene: ENSMUSG00000028958

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
UBQ 102 171 4.58e-4 SMART
low complexity region 175 204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140722
Predicted Effect possibly damaging
Transcript: ENSMUST00000144389
AA Change: R3G

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198276
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase was shown to be activated rapidly during Fas-mediated apoptosis in Jurkat cells. In response to Fas receptor ligation, it phosphorylates TIA1, an apoptosis-promoting nuclear RNA-binding protein. The encoded protein is a strong inducer of lymphocyte apoptosis. Two transcript variants encoding different isoforms have been found for this gene. Other variants exist, but their full-length natures have not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele lack neutophil infiltration in a model of house dust mite induced allergic pulmonary inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,030,917 V1437E probably null Het
Adam12 G A 7: 134,012,288 R80* probably null Het
Adgrb3 G T 1: 25,093,957 F479L probably damaging Het
Atf7ip T A 6: 136,605,487 V1165E possibly damaging Het
Atm C T 9: 53,467,964 probably null Het
Atp11c A G X: 60,276,783 Y593H probably damaging Het
Btnl1 A G 17: 34,385,634 D463G possibly damaging Het
Cdc34b T G 11: 94,742,426 W151G probably damaging Het
Cdkal1 A G 13: 29,354,677 S500P possibly damaging Het
Cenpf T C 1: 189,658,642 N998D probably benign Het
Ces2e T A 8: 104,932,539 probably null Het
Chd7 A G 4: 8,753,147 Q548R probably damaging Het
Chfr T A 5: 110,144,761 probably null Het
Clu A G 14: 65,974,841 probably null Het
Cntnap5c A G 17: 58,407,722 D1235G probably damaging Het
Col6a4 T C 9: 106,066,661 S1205G probably benign Het
Ddx47 G T 6: 135,015,350 E113* probably null Het
Dock4 A G 12: 40,745,668 Y828C probably benign Het
Dync1h1 T A 12: 110,656,631 N3553K possibly damaging Het
Egflam C T 15: 7,234,279 C730Y probably damaging Het
Fam83b T C 9: 76,491,016 Y935C probably damaging Het
Fam83g A G 11: 61,703,684 I681M probably benign Het
Fxr1 A T 3: 34,058,047 E367D probably damaging Het
Gatb A G 3: 85,611,370 D261G probably damaging Het
Gm5617 T C 9: 48,495,817 S84P possibly damaging Het
Gm6614 T C 6: 141,980,978 I541V probably damaging Het
Hecw1 C T 13: 14,377,700 E104K probably damaging Het
Il31ra T C 13: 112,543,888 K265R possibly damaging Het
Khsrp GTCATT GT 17: 57,024,410 probably null Het
Lrp2 T A 2: 69,511,067 D923V probably damaging Het
Ltn1 A G 16: 87,382,713 L1520P probably damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Map1s T G 8: 70,913,882 V477G probably benign Het
Mical1 T C 10: 41,482,712 L542P probably damaging Het
Mycbp2 T C 14: 103,208,893 Y1800C probably damaging Het
Mylk A T 16: 34,986,476 D1697V probably benign Het
Nlrp1a A T 11: 71,124,188 F79I probably benign Het
Olfr653 T C 7: 104,579,641 probably benign Het
Pde9a A G 17: 31,386,310 Y6C probably damaging Het
Plxnd1 A T 6: 115,957,548 I1808N probably damaging Het
Ppp1r13b T A 12: 111,833,733 T537S probably benign Het
Ppp2r2a A G 14: 67,016,475 F415L possibly damaging Het
Rabgap1 C T 2: 37,563,487 R976* probably null Het
Rbfox3 T C 11: 118,497,016 H195R probably damaging Het
Ripk4 A T 16: 97,743,733 D571E probably damaging Het
Sdhaf4 T A 1: 24,005,553 R16S probably benign Het
Slc17a1 G T 13: 23,875,675 G130* probably null Het
Slc6a1 G T 6: 114,302,016 A23S probably benign Het
Soga3 T A 10: 29,196,399 Y562* probably null Het
Spock1 T A 13: 57,436,139 Q321L probably damaging Het
Syne2 A G 12: 75,952,786 I2318V probably damaging Het
Terf2ip T C 8: 112,011,639 V53A possibly damaging Het
Thrb T C 14: 18,033,487 F403L probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Uqcrfs1 T C 13: 30,540,804 K251R probably benign Het
Vmn2r111 T C 17: 22,573,104 E57G possibly damaging Het
Vmn2r114 T A 17: 23,291,763 Y581F probably damaging Het
Vps13d A G 4: 145,148,339 V1866A probably benign Het
Washc5 A T 15: 59,369,234 F84Y probably damaging Het
Yars T A 4: 129,197,199 Y28* probably null Het
Zfp638 A G 6: 83,928,982 Y43C probably damaging Het
Zfp750 T A 11: 121,513,932 H39L probably damaging Het
Zfr2 C A 10: 81,242,901 S322R probably damaging Het
Zzef1 A G 11: 72,880,624 D1644G probably benign Het
Other mutations in Fastk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02149:Fastk APN 5 24444053 missense probably damaging 0.99
IGL02313:Fastk APN 5 24443092 missense probably damaging 1.00
IGL02374:Fastk APN 5 24444249 missense possibly damaging 0.48
R0244:Fastk UTSW 5 24442178 splice site probably benign
R0733:Fastk UTSW 5 24443923 missense probably null 0.61
R1181:Fastk UTSW 5 24441731 critical splice donor site probably null
R1558:Fastk UTSW 5 24444047 unclassified probably null
R1735:Fastk UTSW 5 24441803 missense probably damaging 1.00
R1815:Fastk UTSW 5 24441531 missense probably damaging 1.00
R3934:Fastk UTSW 5 24442259 nonsense probably null
R4608:Fastk UTSW 5 24443119 missense probably damaging 1.00
R6671:Fastk UTSW 5 24441609 missense probably damaging 0.99
X0022:Fastk UTSW 5 24444278 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGTGAGCTATCTGCCAAGGC -3'
(R):5'- TCCTGAGTGCTCAAGCTACC -3'

Sequencing Primer
(F):5'- TATCTGCCAAGGCGCGGAG -3'
(R):5'- AGTGCTCAAGCTACCCCAGG -3'
Posted On2014-10-01