Incidental Mutation 'R2134:Ddx47'
ID233628
Institutional Source Beutler Lab
Gene Symbol Ddx47
Ensembl Gene ENSMUSG00000030204
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 47
Synonyms
MMRRC Submission 040137-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R2134 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location135011612-135023776 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 135015350 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 113 (E113*)
Ref Sequence ENSEMBL: ENSMUSP00000145463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032326] [ENSMUST00000130851] [ENSMUST00000205055] [ENSMUST00000205244]
Predicted Effect probably null
Transcript: ENSMUST00000032326
AA Change: E113*
SMART Domains Protein: ENSMUSP00000032326
Gene: ENSMUSG00000030204
AA Change: E113*

DomainStartEndE-ValueType
low complexity region 16 23 N/A INTRINSIC
DEXDc 43 241 6.38e-61 SMART
HELICc 277 358 8.21e-32 SMART
low complexity region 413 437 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123022
Predicted Effect probably benign
Transcript: ENSMUST00000130851
SMART Domains Protein: ENSMUSP00000115183
Gene: ENSMUSG00000030204

DomainStartEndE-ValueType
low complexity region 16 23 N/A INTRINSIC
Blast:DEXDc 30 59 9e-12 BLAST
Pfam:Helicase_C 99 138 2.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134549
Predicted Effect probably null
Transcript: ENSMUST00000154558
AA Change: E109*
SMART Domains Protein: ENSMUSP00000119231
Gene: ENSMUSG00000030204
AA Change: E109*

DomainStartEndE-ValueType
low complexity region 13 20 N/A INTRINSIC
DEXDc 40 238 6.38e-61 SMART
HELICc 229 306 3.67e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155698
Predicted Effect probably null
Transcript: ENSMUST00000204646
AA Change: E112*
Predicted Effect probably null
Transcript: ENSMUST00000205055
AA Change: E113*
SMART Domains Protein: ENSMUSP00000145463
Gene: ENSMUSG00000030204
AA Change: E113*

DomainStartEndE-ValueType
low complexity region 16 23 N/A INTRINSIC
DEXDc 43 178 1.7e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205244
SMART Domains Protein: ENSMUSP00000145139
Gene: ENSMUSG00000030204

DomainStartEndE-ValueType
DEXDc 6 178 3e-15 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene can shuttle between the nucleus and the cytoplasm, and has an RNA-independent ATPase activity. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,030,917 V1437E probably null Het
Adam12 G A 7: 134,012,288 R80* probably null Het
Adgrb3 G T 1: 25,093,957 F479L probably damaging Het
Atf7ip T A 6: 136,605,487 V1165E possibly damaging Het
Atm C T 9: 53,467,964 probably null Het
Atp11c A G X: 60,276,783 Y593H probably damaging Het
Btnl1 A G 17: 34,385,634 D463G possibly damaging Het
Cdc34b T G 11: 94,742,426 W151G probably damaging Het
Cdkal1 A G 13: 29,354,677 S500P possibly damaging Het
Cenpf T C 1: 189,658,642 N998D probably benign Het
Ces2e T A 8: 104,932,539 probably null Het
Chd7 A G 4: 8,753,147 Q548R probably damaging Het
Chfr T A 5: 110,144,761 probably null Het
Clu A G 14: 65,974,841 probably null Het
Cntnap5c A G 17: 58,407,722 D1235G probably damaging Het
Col6a4 T C 9: 106,066,661 S1205G probably benign Het
Dock4 A G 12: 40,745,668 Y828C probably benign Het
Dync1h1 T A 12: 110,656,631 N3553K possibly damaging Het
Egflam C T 15: 7,234,279 C730Y probably damaging Het
Fam83b T C 9: 76,491,016 Y935C probably damaging Het
Fam83g A G 11: 61,703,684 I681M probably benign Het
Fastk T C 5: 24,445,141 R3G probably damaging Het
Fxr1 A T 3: 34,058,047 E367D probably damaging Het
Gatb A G 3: 85,611,370 D261G probably damaging Het
Gm5617 T C 9: 48,495,817 S84P possibly damaging Het
Gm6614 T C 6: 141,980,978 I541V probably damaging Het
Hecw1 C T 13: 14,377,700 E104K probably damaging Het
Il31ra T C 13: 112,543,888 K265R possibly damaging Het
Khsrp GTCATT GT 17: 57,024,410 probably null Het
Lrp2 T A 2: 69,511,067 D923V probably damaging Het
Ltn1 A G 16: 87,382,713 L1520P probably damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Map1s T G 8: 70,913,882 V477G probably benign Het
Mical1 T C 10: 41,482,712 L542P probably damaging Het
Mycbp2 T C 14: 103,208,893 Y1800C probably damaging Het
Mylk A T 16: 34,986,476 D1697V probably benign Het
Nlrp1a A T 11: 71,124,188 F79I probably benign Het
Olfr653 T C 7: 104,579,641 probably benign Het
Pde9a A G 17: 31,386,310 Y6C probably damaging Het
Plxnd1 A T 6: 115,957,548 I1808N probably damaging Het
Ppp1r13b T A 12: 111,833,733 T537S probably benign Het
Ppp2r2a A G 14: 67,016,475 F415L possibly damaging Het
Rabgap1 C T 2: 37,563,487 R976* probably null Het
Rbfox3 T C 11: 118,497,016 H195R probably damaging Het
Ripk4 A T 16: 97,743,733 D571E probably damaging Het
Sdhaf4 T A 1: 24,005,553 R16S probably benign Het
Slc17a1 G T 13: 23,875,675 G130* probably null Het
Slc6a1 G T 6: 114,302,016 A23S probably benign Het
Soga3 T A 10: 29,196,399 Y562* probably null Het
Spock1 T A 13: 57,436,139 Q321L probably damaging Het
Syne2 A G 12: 75,952,786 I2318V probably damaging Het
Terf2ip T C 8: 112,011,639 V53A possibly damaging Het
Thrb T C 14: 18,033,487 F403L probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Uqcrfs1 T C 13: 30,540,804 K251R probably benign Het
Vmn2r111 T C 17: 22,573,104 E57G possibly damaging Het
Vmn2r114 T A 17: 23,291,763 Y581F probably damaging Het
Vps13d A G 4: 145,148,339 V1866A probably benign Het
Washc5 A T 15: 59,369,234 F84Y probably damaging Het
Yars T A 4: 129,197,199 Y28* probably null Het
Zfp638 A G 6: 83,928,982 Y43C probably damaging Het
Zfp750 T A 11: 121,513,932 H39L probably damaging Het
Zfr2 C A 10: 81,242,901 S322R probably damaging Het
Zzef1 A G 11: 72,880,624 D1644G probably benign Het
Other mutations in Ddx47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02719:Ddx47 APN 6 135017151 missense probably benign 0.06
PIT4466001:Ddx47 UTSW 6 135015840 missense probably benign 0.31
R0304:Ddx47 UTSW 6 135017220 missense possibly damaging 0.62
R0617:Ddx47 UTSW 6 135017122 missense probably damaging 1.00
R1223:Ddx47 UTSW 6 135012314 missense possibly damaging 0.70
R1468:Ddx47 UTSW 6 135011740 splice site probably benign
R2005:Ddx47 UTSW 6 135018121 missense probably benign 0.06
R2993:Ddx47 UTSW 6 135018981 missense probably damaging 1.00
R3714:Ddx47 UTSW 6 135019062 missense probably damaging 1.00
R4352:Ddx47 UTSW 6 135018055 missense probably benign 0.38
R4355:Ddx47 UTSW 6 135021505 missense probably benign
R4495:Ddx47 UTSW 6 135021466 missense possibly damaging 0.62
R4664:Ddx47 UTSW 6 135012356 missense possibly damaging 0.95
R5527:Ddx47 UTSW 6 135011694 missense probably benign 0.35
R6119:Ddx47 UTSW 6 135023355 missense probably benign
R7038:Ddx47 UTSW 6 135023373 missense possibly damaging 0.84
R7270:Ddx47 UTSW 6 135023338 missense probably benign 0.08
X0026:Ddx47 UTSW 6 135023389 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTCAGAGTGCCTTTCTTTG -3'
(R):5'- TTCTCAGTGAGCACCTTCAAGC -3'

Sequencing Primer
(F):5'- GCTCAGAGTGCCTTTCTTTGTAAAAG -3'
(R):5'- GTGAGCACCTTCAAGCCAATATTAG -3'
Posted On2014-10-01