Incidental Mutation 'R2134:Clu'
ID233666
Institutional Source Beutler Lab
Gene Symbol Clu
Ensembl Gene ENSMUSG00000022037
Gene Nameclusterin
SynonymsD14Ucla3, Sgp-2, Sgp2, ApoJ, Cli, SP-40, Sugp-2, complement lysis inhibitor, Apolipoprotein J, testosterone repressed prostate message-2
MMRRC Submission 040137-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R2134 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location65968483-65981547 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 65974841 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022616] [ENSMUST00000127387] [ENSMUST00000128539] [ENSMUST00000138191] [ENSMUST00000138191] [ENSMUST00000138665] [ENSMUST00000144619] [ENSMUST00000153460]
Predicted Effect probably null
Transcript: ENSMUST00000022616
SMART Domains Protein: ENSMUSP00000022616
Gene: ENSMUSG00000022037

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 226 9.93e-152 SMART
CLa 227 442 2.3e-156 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127387
SMART Domains Protein: ENSMUSP00000114720
Gene: ENSMUSG00000022037

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 226 9.93e-152 SMART
Predicted Effect probably null
Transcript: ENSMUST00000128539
SMART Domains Protein: ENSMUSP00000121485
Gene: ENSMUSG00000022037

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 203 3.48e-124 SMART
Predicted Effect probably null
Transcript: ENSMUST00000138191
SMART Domains Protein: ENSMUSP00000117555
Gene: ENSMUSG00000022037

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 225 2.18e-148 SMART
Predicted Effect probably null
Transcript: ENSMUST00000138191
SMART Domains Protein: ENSMUSP00000117555
Gene: ENSMUSG00000022037

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 225 2.18e-148 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138665
Predicted Effect probably null
Transcript: ENSMUST00000144619
SMART Domains Protein: ENSMUSP00000117953
Gene: ENSMUSG00000022037

DomainStartEndE-ValueType
low complexity region 92 100 N/A INTRINSIC
CLb 110 209 1.16e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152903
Predicted Effect probably null
Transcript: ENSMUST00000153460
SMART Domains Protein: ENSMUSP00000121633
Gene: ENSMUSG00000022037

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 226 9.93e-152 SMART
Blast:CLa 227 265 2e-19 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a secreted chaperone that can, under some stress conditions, also be found in the cell cytosol. It has been suggested to be involved in several basic biological events such as cell death, tumor progression, and neurodegenerative disorders. The encoded preproprotein undergoes proteolytic processing to generate a disulfide-linked heterodimeric mature protein comprised of alpha and beta subunits. Mice lacking the encoded protein exhibit increased severity of autoimmune myocarditis, faster progression of the acute inflammation to myocardial scarring and decreased brain injury following neonatal hypoxic-ischemic injury. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to progressive renal glomerulopathy and increased severity of myosin-induced autoimmune myocarditis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,030,917 V1437E probably null Het
Adam12 G A 7: 134,012,288 R80* probably null Het
Adgrb3 G T 1: 25,093,957 F479L probably damaging Het
Atf7ip T A 6: 136,605,487 V1165E possibly damaging Het
Atm C T 9: 53,467,964 probably null Het
Atp11c A G X: 60,276,783 Y593H probably damaging Het
Btnl1 A G 17: 34,385,634 D463G possibly damaging Het
Cdc34b T G 11: 94,742,426 W151G probably damaging Het
Cdkal1 A G 13: 29,354,677 S500P possibly damaging Het
Cenpf T C 1: 189,658,642 N998D probably benign Het
Ces2e T A 8: 104,932,539 probably null Het
Chd7 A G 4: 8,753,147 Q548R probably damaging Het
Chfr T A 5: 110,144,761 probably null Het
Cntnap5c A G 17: 58,407,722 D1235G probably damaging Het
Col6a4 T C 9: 106,066,661 S1205G probably benign Het
Ddx47 G T 6: 135,015,350 E113* probably null Het
Dock4 A G 12: 40,745,668 Y828C probably benign Het
Dync1h1 T A 12: 110,656,631 N3553K possibly damaging Het
Egflam C T 15: 7,234,279 C730Y probably damaging Het
Fam83b T C 9: 76,491,016 Y935C probably damaging Het
Fam83g A G 11: 61,703,684 I681M probably benign Het
Fastk T C 5: 24,445,141 R3G probably damaging Het
Fxr1 A T 3: 34,058,047 E367D probably damaging Het
Gatb A G 3: 85,611,370 D261G probably damaging Het
Gm5617 T C 9: 48,495,817 S84P possibly damaging Het
Gm6614 T C 6: 141,980,978 I541V probably damaging Het
Hecw1 C T 13: 14,377,700 E104K probably damaging Het
Il31ra T C 13: 112,543,888 K265R possibly damaging Het
Khsrp GTCATT GT 17: 57,024,410 probably null Het
Lrp2 T A 2: 69,511,067 D923V probably damaging Het
Ltn1 A G 16: 87,382,713 L1520P probably damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Map1s T G 8: 70,913,882 V477G probably benign Het
Mical1 T C 10: 41,482,712 L542P probably damaging Het
Mycbp2 T C 14: 103,208,893 Y1800C probably damaging Het
Mylk A T 16: 34,986,476 D1697V probably benign Het
Nlrp1a A T 11: 71,124,188 F79I probably benign Het
Olfr653 T C 7: 104,579,641 probably benign Het
Pde9a A G 17: 31,386,310 Y6C probably damaging Het
Plxnd1 A T 6: 115,957,548 I1808N probably damaging Het
Ppp1r13b T A 12: 111,833,733 T537S probably benign Het
Ppp2r2a A G 14: 67,016,475 F415L possibly damaging Het
Rabgap1 C T 2: 37,563,487 R976* probably null Het
Rbfox3 T C 11: 118,497,016 H195R probably damaging Het
Ripk4 A T 16: 97,743,733 D571E probably damaging Het
Sdhaf4 T A 1: 24,005,553 R16S probably benign Het
Slc17a1 G T 13: 23,875,675 G130* probably null Het
Slc6a1 G T 6: 114,302,016 A23S probably benign Het
Soga3 T A 10: 29,196,399 Y562* probably null Het
Spock1 T A 13: 57,436,139 Q321L probably damaging Het
Syne2 A G 12: 75,952,786 I2318V probably damaging Het
Terf2ip T C 8: 112,011,639 V53A possibly damaging Het
Thrb T C 14: 18,033,487 F403L probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Uqcrfs1 T C 13: 30,540,804 K251R probably benign Het
Vmn2r111 T C 17: 22,573,104 E57G possibly damaging Het
Vmn2r114 T A 17: 23,291,763 Y581F probably damaging Het
Vps13d A G 4: 145,148,339 V1866A probably benign Het
Washc5 A T 15: 59,369,234 F84Y probably damaging Het
Yars T A 4: 129,197,199 Y28* probably null Het
Zfp638 A G 6: 83,928,982 Y43C probably damaging Het
Zfp750 T A 11: 121,513,932 H39L probably damaging Het
Zfr2 C A 10: 81,242,901 S322R probably damaging Het
Zzef1 A G 11: 72,880,624 D1644G probably benign Het
Other mutations in Clu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Clu APN 14 65975588 missense probably damaging 0.98
IGL01657:Clu APN 14 65979672 missense possibly damaging 0.81
IGL02030:Clu APN 14 65975791 missense probably benign 0.08
IGL02891:Clu APN 14 65975984 missense probably damaging 0.96
IGL03163:Clu APN 14 65979786 missense probably benign 0.06
R1378:Clu UTSW 14 65974901 missense probably damaging 1.00
R1417:Clu UTSW 14 65974971 nonsense probably null
R1711:Clu UTSW 14 65980905 missense possibly damaging 0.63
R2285:Clu UTSW 14 65980959 missense probably benign 0.03
R2340:Clu UTSW 14 65980909 missense probably damaging 0.99
R2508:Clu UTSW 14 65975003 missense probably damaging 1.00
R4700:Clu UTSW 14 65979864 missense probably benign 0.25
R4981:Clu UTSW 14 65973366 missense probably damaging 0.97
R5062:Clu UTSW 14 65979728 missense probably damaging 0.99
R5422:Clu UTSW 14 65975602 missense probably damaging 0.99
R6389:Clu UTSW 14 65971322 intron probably benign
R7009:Clu UTSW 14 65971832 missense probably damaging 1.00
X0025:Clu UTSW 14 65971814 missense probably damaging 1.00
Z1088:Clu UTSW 14 65976913 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACGGTCAGAGCAGCAGATC -3'
(R):5'- AGGCTGTGGACATCTCTCC -3'

Sequencing Primer
(F):5'- TCAGAGCAGCAGATCAGAGTG -3'
(R):5'- GGCTGTGGACATCTCTCCTTCTC -3'
Posted On2014-10-01