Incidental Mutation 'R2134:Vmn2r114'
ID233675
Institutional Source Beutler Lab
Gene Symbol Vmn2r114
Ensembl Gene ENSMUSG00000091945
Gene Namevomeronasal 2, receptor 114
SynonymsEG666002
MMRRC Submission 040137-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R2134 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location23290934-23312313 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23291763 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 581 (Y581F)
Ref Sequence ENSEMBL: ENSMUSP00000127505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168033]
Predicted Effect probably damaging
Transcript: ENSMUST00000168033
AA Change: Y581F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127505
Gene: ENSMUSG00000091945
AA Change: Y581F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 154 470 1.5e-24 PFAM
Pfam:NCD3G 511 564 1.5e-18 PFAM
Pfam:7tm_3 597 832 1.4e-55 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,030,917 V1437E probably null Het
Adam12 G A 7: 134,012,288 R80* probably null Het
Adgrb3 G T 1: 25,093,957 F479L probably damaging Het
Atf7ip T A 6: 136,605,487 V1165E possibly damaging Het
Atm C T 9: 53,467,964 probably null Het
Atp11c A G X: 60,276,783 Y593H probably damaging Het
Btnl1 A G 17: 34,385,634 D463G possibly damaging Het
Cdc34b T G 11: 94,742,426 W151G probably damaging Het
Cdkal1 A G 13: 29,354,677 S500P possibly damaging Het
Cenpf T C 1: 189,658,642 N998D probably benign Het
Ces2e T A 8: 104,932,539 probably null Het
Chd7 A G 4: 8,753,147 Q548R probably damaging Het
Chfr T A 5: 110,144,761 probably null Het
Clu A G 14: 65,974,841 probably null Het
Cntnap5c A G 17: 58,407,722 D1235G probably damaging Het
Col6a4 T C 9: 106,066,661 S1205G probably benign Het
Ddx47 G T 6: 135,015,350 E113* probably null Het
Dock4 A G 12: 40,745,668 Y828C probably benign Het
Dync1h1 T A 12: 110,656,631 N3553K possibly damaging Het
Egflam C T 15: 7,234,279 C730Y probably damaging Het
Fam83b T C 9: 76,491,016 Y935C probably damaging Het
Fam83g A G 11: 61,703,684 I681M probably benign Het
Fastk T C 5: 24,445,141 R3G probably damaging Het
Fxr1 A T 3: 34,058,047 E367D probably damaging Het
Gatb A G 3: 85,611,370 D261G probably damaging Het
Gm5617 T C 9: 48,495,817 S84P possibly damaging Het
Gm6614 T C 6: 141,980,978 I541V probably damaging Het
Hecw1 C T 13: 14,377,700 E104K probably damaging Het
Il31ra T C 13: 112,543,888 K265R possibly damaging Het
Khsrp GTCATT GT 17: 57,024,410 probably null Het
Lrp2 T A 2: 69,511,067 D923V probably damaging Het
Ltn1 A G 16: 87,382,713 L1520P probably damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Map1s T G 8: 70,913,882 V477G probably benign Het
Mical1 T C 10: 41,482,712 L542P probably damaging Het
Mycbp2 T C 14: 103,208,893 Y1800C probably damaging Het
Mylk A T 16: 34,986,476 D1697V probably benign Het
Nlrp1a A T 11: 71,124,188 F79I probably benign Het
Olfr653 T C 7: 104,579,641 probably benign Het
Pde9a A G 17: 31,386,310 Y6C probably damaging Het
Plxnd1 A T 6: 115,957,548 I1808N probably damaging Het
Ppp1r13b T A 12: 111,833,733 T537S probably benign Het
Ppp2r2a A G 14: 67,016,475 F415L possibly damaging Het
Rabgap1 C T 2: 37,563,487 R976* probably null Het
Rbfox3 T C 11: 118,497,016 H195R probably damaging Het
Ripk4 A T 16: 97,743,733 D571E probably damaging Het
Sdhaf4 T A 1: 24,005,553 R16S probably benign Het
Slc17a1 G T 13: 23,875,675 G130* probably null Het
Slc6a1 G T 6: 114,302,016 A23S probably benign Het
Soga3 T A 10: 29,196,399 Y562* probably null Het
Spock1 T A 13: 57,436,139 Q321L probably damaging Het
Syne2 A G 12: 75,952,786 I2318V probably damaging Het
Terf2ip T C 8: 112,011,639 V53A possibly damaging Het
Thrb T C 14: 18,033,487 F403L probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Uqcrfs1 T C 13: 30,540,804 K251R probably benign Het
Vmn2r111 T C 17: 22,573,104 E57G possibly damaging Het
Vps13d A G 4: 145,148,339 V1866A probably benign Het
Washc5 A T 15: 59,369,234 F84Y probably damaging Het
Yars T A 4: 129,197,199 Y28* probably null Het
Zfp638 A G 6: 83,928,982 Y43C probably damaging Het
Zfp750 T A 11: 121,513,932 H39L probably damaging Het
Zfr2 C A 10: 81,242,901 S322R probably damaging Het
Zzef1 A G 11: 72,880,624 D1644G probably benign Het
Other mutations in Vmn2r114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Vmn2r114 APN 17 23291665 missense probably damaging 1.00
IGL00990:Vmn2r114 APN 17 23290965 missense probably benign
IGL00990:Vmn2r114 APN 17 23290983 missense probably benign 0.23
IGL00990:Vmn2r114 APN 17 23291238 missense probably damaging 1.00
IGL01838:Vmn2r114 APN 17 23296982 missense probably benign 0.44
IGL01990:Vmn2r114 APN 17 23310381 missense probably benign 0.22
IGL01994:Vmn2r114 APN 17 23310477 missense probably damaging 1.00
IGL02153:Vmn2r114 APN 17 23291808 missense probably benign 0.01
IGL02453:Vmn2r114 APN 17 23311134 missense probably benign 0.00
IGL02621:Vmn2r114 APN 17 23310520 missense probably damaging 0.98
IGL02938:Vmn2r114 APN 17 23291289 missense probably benign 0.10
IGL03130:Vmn2r114 APN 17 23296996 splice site probably benign
IGL03325:Vmn2r114 APN 17 23291678 missense probably damaging 1.00
R0109:Vmn2r114 UTSW 17 23310575 nonsense probably null
R0164:Vmn2r114 UTSW 17 23309826 critical splice donor site probably null
R0310:Vmn2r114 UTSW 17 23290943 missense probably benign 0.23
R0583:Vmn2r114 UTSW 17 23290932 makesense probably null
R0677:Vmn2r114 UTSW 17 23310594 missense probably damaging 1.00
R1127:Vmn2r114 UTSW 17 23290932 makesense probably null
R1147:Vmn2r114 UTSW 17 23311063 missense probably benign 0.00
R1147:Vmn2r114 UTSW 17 23311063 missense probably benign 0.00
R1157:Vmn2r114 UTSW 17 23310340 missense possibly damaging 0.60
R1323:Vmn2r114 UTSW 17 23290932 makesense probably null
R1347:Vmn2r114 UTSW 17 23290932 makesense probably null
R1435:Vmn2r114 UTSW 17 23290932 makesense probably null
R1437:Vmn2r114 UTSW 17 23291211 missense probably damaging 1.00
R1585:Vmn2r114 UTSW 17 23291701 missense probably damaging 0.98
R1641:Vmn2r114 UTSW 17 23296988 missense probably benign 0.00
R1748:Vmn2r114 UTSW 17 23308061 missense probably benign 0.17
R1954:Vmn2r114 UTSW 17 23311112 missense probably benign 0.32
R2081:Vmn2r114 UTSW 17 23291109 missense possibly damaging 0.91
R2103:Vmn2r114 UTSW 17 23290932 makesense probably null
R2113:Vmn2r114 UTSW 17 23290932 makesense probably null
R2149:Vmn2r114 UTSW 17 23290932 makesense probably null
R2424:Vmn2r114 UTSW 17 23296868 missense possibly damaging 0.90
R2847:Vmn2r114 UTSW 17 23290974 missense probably benign 0.00
R2848:Vmn2r114 UTSW 17 23290974 missense probably benign 0.00
R2893:Vmn2r114 UTSW 17 23290932 makesense probably null
R3017:Vmn2r114 UTSW 17 23290932 makesense probably null
R3018:Vmn2r114 UTSW 17 23290932 makesense probably null
R3019:Vmn2r114 UTSW 17 23290932 makesense probably null
R3020:Vmn2r114 UTSW 17 23290932 makesense probably null
R3021:Vmn2r114 UTSW 17 23290932 makesense probably null
R4628:Vmn2r114 UTSW 17 23290932 makesense probably null
R4668:Vmn2r114 UTSW 17 23310473 missense possibly damaging 0.83
R4840:Vmn2r114 UTSW 17 23291379 missense probably damaging 0.97
R4841:Vmn2r114 UTSW 17 23310362 missense probably benign 0.04
R4842:Vmn2r114 UTSW 17 23310362 missense probably benign 0.04
R4856:Vmn2r114 UTSW 17 23308034 missense probably benign 0.11
R4886:Vmn2r114 UTSW 17 23308034 missense probably benign 0.11
R4992:Vmn2r114 UTSW 17 23291791 missense probably benign 0.03
R5182:Vmn2r114 UTSW 17 23291658 missense probably damaging 0.96
R5223:Vmn2r114 UTSW 17 23290932 makesense probably null
R5405:Vmn2r114 UTSW 17 23290932 makesense probably null
R5449:Vmn2r114 UTSW 17 23290932 makesense probably null
R5615:Vmn2r114 UTSW 17 23290932 makesense probably null
R5834:Vmn2r114 UTSW 17 23310625 missense possibly damaging 0.90
R6150:Vmn2r114 UTSW 17 23291295 missense probably benign 0.03
R6277:Vmn2r114 UTSW 17 23290980 missense possibly damaging 0.93
R6403:Vmn2r114 UTSW 17 23309965 missense probably damaging 0.99
R6589:Vmn2r114 UTSW 17 23291668 missense probably damaging 1.00
R6613:Vmn2r114 UTSW 17 23310246 missense possibly damaging 0.82
R6747:Vmn2r114 UTSW 17 23309876 missense probably benign 0.00
R6837:Vmn2r114 UTSW 17 23310202 missense probably benign 0.10
R6911:Vmn2r114 UTSW 17 23291130 missense probably damaging 0.98
R6950:Vmn2r114 UTSW 17 23310163 missense probably benign 0.03
R7276:Vmn2r114 UTSW 17 23290960 missense probably damaging 0.97
R7482:Vmn2r114 UTSW 17 23291494 missense probably damaging 1.00
R7514:Vmn2r114 UTSW 17 23308061 missense probably null 0.96
R7523:Vmn2r114 UTSW 17 23310637 missense probably benign 0.01
R7563:Vmn2r114 UTSW 17 23291026 missense probably benign 0.01
X0065:Vmn2r114 UTSW 17 23310957 missense probably benign 0.34
Z1088:Vmn2r114 UTSW 17 23290932 makesense probably null
Predicted Primers PCR Primer
(F):5'- AATGTGATTTGCTGTAGGATGCA -3'
(R):5'- CACACAAAACTCATATGTTGCAAATT -3'

Sequencing Primer
(F):5'- CTGTAGGATGCAGGTGGC -3'
(R):5'- TCCCCATTAGATGTGGATT -3'
Posted On2014-10-01