Incidental Mutation 'R2146:Anxa2'
ID233843
Institutional Source Beutler Lab
Gene Symbol Anxa2
Ensembl Gene ENSMUSG00000032231
Gene Nameannexin A2
Synonymslipocortin II, annexin II, Cal1h, 36-kDa calelectrin
MMRRC Submission 040149-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2146 (G1)
Quality Score102
Status Validated
Chromosome9
Chromosomal Location69453620-69491795 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCCC to TCC at 69489754 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034756] [ENSMUST00000123470] [ENSMUST00000136282]
Predicted Effect probably null
Transcript: ENSMUST00000034756
SMART Domains Protein: ENSMUSP00000034756
Gene: ENSMUSG00000032231

DomainStartEndE-ValueType
ANX 50 102 5.79e-20 SMART
ANX 122 174 1.5e-27 SMART
ANX 207 259 8.2e-11 SMART
ANX 282 334 1.6e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123470
SMART Domains Protein: ENSMUSP00000122175
Gene: ENSMUSG00000032231

DomainStartEndE-ValueType
ANX 50 102 5.79e-20 SMART
ANX 122 174 1.5e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000136282
SMART Domains Protein: ENSMUSP00000117855
Gene: ENSMUSG00000032231

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
ANX 55 107 1.5e-27 SMART
ANX 140 192 8.2e-11 SMART
ANX 215 267 1.6e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154591
Meta Mutation Damage Score 0.6384 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. This protein functions as an autocrine factor which heightens osteoclast formation and bone resorption. This gene has three pseudogenes located on chromosomes 4, 9 and 10, respectively. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are viable and fertile but suffer from growth deficits, impaired angiogenesis, and increased susceptibility to thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,347,844 probably null Het
4933406M09Rik T A 1: 134,390,513 M341K probably damaging Het
9530002B09Rik T A 4: 122,689,405 C13* probably null Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Adamts18 G C 8: 113,845,003 A116G possibly damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap6 A G X: 168,796,500 T94A probably benign Het
Arhgef5 T C 6: 43,283,318 S1413P probably damaging Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
BC005561 T C 5: 104,518,991 F460L probably benign Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccdc185 G T 1: 182,747,520 H535N possibly damaging Het
Ccdc57 A G 11: 120,885,225 probably benign Het
Cd163 A G 6: 124,309,208 H239R probably damaging Het
Ceacam2 G T 7: 25,527,943 C166* probably null Het
Ces5a T A 8: 93,534,699 E33D probably benign Het
Chl1 T C 6: 103,715,401 probably null Het
Chsy3 G A 18: 59,176,472 V266I probably benign Het
Cpa5 G T 6: 30,626,822 R251L probably damaging Het
Cps1 A C 1: 67,152,379 probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cstf1 T C 2: 172,375,763 Y99H probably damaging Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dennd3 C T 15: 73,523,496 T146M probably damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dnajc22 T C 15: 99,104,383 V303A probably benign Het
Dtx2 T G 5: 136,030,610 L458R probably benign Het
Elmsan1 G T 12: 84,173,035 P382T probably damaging Het
Fat3 A T 9: 15,990,512 F3072L probably benign Het
Fgf5 T C 5: 98,275,550 *265R probably null Het
Fndc11 A G 2: 181,222,125 E241G probably damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gm4922 T G 10: 18,783,516 Q486P probably benign Het
Gm5786 A T 12: 59,081,298 noncoding transcript Het
Hepacam2 A T 6: 3,463,378 probably benign Het
Ints9 G A 14: 64,986,343 G89R possibly damaging Het
Iqcm T A 8: 75,888,613 W441R probably damaging Het
Itga10 T C 3: 96,651,492 L382P possibly damaging Het
Itga10 G T 3: 96,653,723 G635W probably damaging Het
Kbtbd2 A G 6: 56,779,090 Y554H probably damaging Het
Kif1b T C 4: 149,184,309 K1649R probably damaging Het
L1cam A T X: 73,861,141 F536Y probably damaging Het
Magee1 A T X: 105,122,958 D783V probably damaging Het
Marveld3 A T 8: 109,959,802 V144E probably benign Het
Mcam T C 9: 44,136,635 V59A probably damaging Het
Mdga2 C T 12: 66,868,741 E47K probably damaging Het
Metrn T A 17: 25,796,627 E38V probably damaging Het
Mfrp T C 9: 44,103,718 L314P probably benign Het
Mospd2 A G X: 164,956,477 probably null Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myh6 C T 14: 54,953,771 R871H probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1104 T A 2: 87,021,665 N293I probably damaging Het
Olfr1465 T C 19: 13,314,121 T55A probably benign Het
Olfr156 A G 4: 43,821,178 F61S probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pdcd11 A G 19: 47,104,752 M490V probably benign Het
Pet2 T C X: 89,406,277 D82G possibly damaging Het
Pkd2 A C 5: 104,455,590 probably benign Het
Reps1 T A 10: 18,093,313 D206E probably benign Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Rnf13 T G 3: 57,802,486 I150S probably null Het
Rxfp4 C T 3: 88,652,893 A84T probably damaging Het
Serpinb8 T A 1: 107,605,927 D237E probably benign Het
Sgo2b T G 8: 63,928,023 T592P probably benign Het
Slc35d1 A T 4: 103,205,152 I228N probably damaging Het
Slc39a1 T G 3: 90,249,450 H104Q probably benign Het
Slc6a6 T C 6: 91,735,180 V230A probably benign Het
Slc9a3 A G 13: 74,121,603 E30G probably benign Het
Slc9c1 A G 16: 45,593,464 Y985C probably benign Het
Supt6 A G 11: 78,230,932 F298S probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tnpo3 A G 6: 29,589,036 V105A probably benign Het
Ttc7 T C 17: 87,346,707 probably benign Het
Ttn T C 2: 76,897,188 probably benign Het
Usp16 T C 16: 87,473,187 probably null Het
Usp36 A G 11: 118,268,665 L486S probably benign Het
Uty T C Y: 1,239,816 I72V probably benign Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Zfp160 A G 17: 21,026,982 K598R probably benign Het
Zfp39 T C 11: 58,890,332 N535D probably benign Het
Zfp804a A G 2: 82,258,664 T946A probably benign Het
Other mutations in Anxa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Anxa2 APN 9 69483019 nonsense probably null
IGL02550:Anxa2 APN 9 69467306 missense probably benign 0.00
FR4342:Anxa2 UTSW 9 69480205 small insertion probably benign
FR4342:Anxa2 UTSW 9 69480210 small insertion probably benign
FR4548:Anxa2 UTSW 9 69480203 small insertion probably benign
FR4589:Anxa2 UTSW 9 69480210 small insertion probably benign
R1480:Anxa2 UTSW 9 69489754 frame shift probably null
R1482:Anxa2 UTSW 9 69489754 frame shift probably null
R1519:Anxa2 UTSW 9 69485241 missense probably damaging 1.00
R1609:Anxa2 UTSW 9 69489754 frame shift probably null
R1610:Anxa2 UTSW 9 69489754 frame shift probably null
R1624:Anxa2 UTSW 9 69479708 missense probably benign 0.10
R1672:Anxa2 UTSW 9 69489754 frame shift probably null
R1696:Anxa2 UTSW 9 69489754 frame shift probably null
R1760:Anxa2 UTSW 9 69489767 missense probably benign 0.00
R1775:Anxa2 UTSW 9 69488081 missense possibly damaging 0.93
R1828:Anxa2 UTSW 9 69482978 missense probably damaging 1.00
R1884:Anxa2 UTSW 9 69489754 frame shift probably null
R1991:Anxa2 UTSW 9 69483816 missense probably damaging 1.00
R2020:Anxa2 UTSW 9 69483817 missense probably damaging 0.99
R2029:Anxa2 UTSW 9 69464480 missense possibly damaging 0.71
R2103:Anxa2 UTSW 9 69483816 missense probably damaging 1.00
R2129:Anxa2 UTSW 9 69476128 missense possibly damaging 0.48
R2148:Anxa2 UTSW 9 69489754 frame shift probably null
R2149:Anxa2 UTSW 9 69489754 frame shift probably null
R2150:Anxa2 UTSW 9 69489754 frame shift probably null
R2437:Anxa2 UTSW 9 69489764 missense probably damaging 1.00
R3848:Anxa2 UTSW 9 69467342 missense probably damaging 1.00
R4036:Anxa2 UTSW 9 69488070 missense probably damaging 0.99
R4565:Anxa2 UTSW 9 69489737 missense probably damaging 1.00
R4731:Anxa2 UTSW 9 69486530 missense probably benign 0.41
R5172:Anxa2 UTSW 9 69485251 missense probably damaging 0.99
R5181:Anxa2 UTSW 9 69476065 missense probably benign 0.00
R6427:Anxa2 UTSW 9 69476149 critical splice donor site probably null
R6759:Anxa2 UTSW 9 69483821 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACGACCCACATGAGTGC -3'
(R):5'- AGGTCACCACTCTGCCATTG -3'

Sequencing Primer
(F):5'- CAGCTTTAGGGGATCTGACACTC -3'
(R):5'- GCCATTGTTCTCTACAGCCAC -3'
Posted On2014-10-01