Incidental Mutation 'R2147:Skint8'
ID233895
Institutional Source Beutler Lab
Gene Symbol Skint8
Ensembl Gene ENSMUSG00000078599
Gene Nameselection and upkeep of intraepithelial T cells 8
SynonymsOTTMUSG00000009475
MMRRC Submission 040150-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R2147 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location111919392-111950358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 111937077 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 221 (N221K)
Ref Sequence ENSEMBL: ENSMUSP00000133268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106572] [ENSMUST00000165046]
Predicted Effect probably damaging
Transcript: ENSMUST00000106572
AA Change: N221K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102182
Gene: ENSMUSG00000078599
AA Change: N221K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 3.13e-5 SMART
Blast:IG_like 148 231 9e-16 BLAST
transmembrane domain 243 265 N/A INTRINSIC
transmembrane domain 285 307 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124862
Predicted Effect probably damaging
Transcript: ENSMUST00000165046
AA Change: N221K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133268
Gene: ENSMUSG00000078599
AA Change: N221K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 34 141 3.13e-5 SMART
transmembrane domain 243 265 N/A INTRINSIC
transmembrane domain 285 307 N/A INTRINSIC
transmembrane domain 327 352 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,571 D647G probably benign Het
4930523C07Rik T A 1: 160,075,433 M91K probably benign Het
Abr T C 11: 76,455,648 R437G probably damaging Het
Acaca T G 11: 84,276,536 D1045E probably benign Het
Adam23 A T 1: 63,534,362 probably null Het
Adam34 A G 8: 43,652,501 Y36H probably benign Het
Alg11 G A 8: 22,065,293 G108D probably damaging Het
Alox12e A T 11: 70,319,945 I316N probably damaging Het
Arid1a A T 4: 133,681,366 F1943L unknown Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC035044 T C 6: 128,890,904 probably benign Het
Bcor G A X: 12,057,623 A578V possibly damaging Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccnf A T 17: 24,230,314 probably null Het
Cdadc1 A G 14: 59,597,753 probably null Het
Cep57l1 A G 10: 41,740,899 Y131H probably damaging Het
Cfap44 A G 16: 44,451,684 R1267G probably benign Het
Chd3 A T 11: 69,349,028 L1658Q probably benign Het
Chl1 T C 6: 103,715,401 probably null Het
Chpf2 T A 5: 24,592,035 F660I probably damaging Het
Cmas T A 6: 142,771,289 D302E probably benign Het
Cpne3 T A 4: 19,536,562 M233L probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D430042O09Rik T A 7: 125,865,320 H1286Q probably damaging Het
Dennd3 T G 15: 73,523,487 L143R probably damaging Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dock2 A G 11: 34,229,472 probably null Het
Ergic1 A G 17: 26,636,050 probably null Het
Fbxl15 A T 19: 46,329,188 D103V probably damaging Het
Gm4781 C A 10: 100,396,552 noncoding transcript Het
Hpca A G 4: 129,118,485 I86T possibly damaging Het
Lamb3 T C 1: 193,327,904 V275A probably benign Het
Lipe G T 7: 25,388,521 A38E probably benign Het
Lrrk1 A T 7: 66,285,411 probably null Het
Lrsam1 T C 2: 32,945,879 K292R probably damaging Het
Mbtps1 A T 8: 119,538,859 H316Q probably benign Het
Mms22l T A 4: 24,580,063 Y525* probably null Het
Mrps14 T C 1: 160,195,292 L9P possibly damaging Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myo15 A G 11: 60,510,229 D2992G possibly damaging Het
N4bp2 T A 5: 65,809,200 L1327Q probably damaging Het
Nradd A T 9: 110,622,175 F42I probably benign Het
Olfr175-ps1 T A 16: 58,824,479 I77F probably damaging Het
Pank1 T C 19: 34,827,354 H134R probably benign Het
Pcdh7 T A 5: 58,129,116 M1178K possibly damaging Het
Pcnx3 A T 19: 5,667,605 I1084N probably damaging Het
Pdcd11 A G 19: 47,104,752 M490V probably benign Het
Phf2 T C 13: 48,804,689 K950E unknown Het
Pitpnc1 C T 11: 107,212,518 A252T probably damaging Het
Prickle2 A G 6: 92,425,671 L112P probably damaging Het
Prpf8 A G 11: 75,490,531 I231V probably benign Het
Scin T A 12: 40,080,985 M310L probably benign Het
Serpina3m T A 12: 104,389,224 I50N probably benign Het
Slc22a23 C T 13: 34,183,007 V673M probably benign Het
Slc24a5 A G 2: 125,087,441 D368G probably damaging Het
Slc28a1 A T 7: 81,126,267 Q237L possibly damaging Het
Smchd1 T A 17: 71,398,588 K1005N possibly damaging Het
Stim2 T C 5: 54,105,375 Y320H probably damaging Het
Syne3 T A 12: 104,953,098 D512V probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Tcp10a T C 17: 7,334,302 S216P probably damaging Het
Tmem178b A T 6: 40,207,501 Q111L probably damaging Het
Tmem236 A G 2: 14,219,050 I217V probably benign Het
Tmem45b A G 9: 31,428,981 V128A probably benign Het
Tnfaip2 T C 12: 111,446,022 Y286H probably damaging Het
Tsc2 T A 17: 24,621,142 I427L possibly damaging Het
Ttc17 T A 2: 94,301,794 N1180I possibly damaging Het
Ubr1 T G 2: 120,864,330 D1707A probably damaging Het
Vmn1r11 A G 6: 57,137,598 I82M probably benign Het
Vmn2r-ps159 T C 4: 156,334,719 noncoding transcript Het
Vps41 G T 13: 18,839,734 probably null Het
Wdr66 T C 5: 123,256,191 V381A probably benign Het
Wnt5a A G 14: 28,513,317 Y86C probably damaging Het
Zfp629 T C 7: 127,610,444 H731R probably damaging Het
Zfp712 T C 13: 67,041,896 E189G possibly damaging Het
Other mutations in Skint8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Skint8 APN 4 111938923 missense probably benign 0.05
IGL01411:Skint8 APN 4 111936906 missense probably damaging 0.97
IGL02973:Skint8 APN 4 111939593 missense probably benign 0.09
IGL03154:Skint8 APN 4 111939510 splice site probably null
FR4976:Skint8 UTSW 4 111938902 missense probably benign 0.02
R0309:Skint8 UTSW 4 111938867 missense probably benign 0.02
R0448:Skint8 UTSW 4 111936890 missense probably damaging 1.00
R0483:Skint8 UTSW 4 111938823 splice site probably benign
R0586:Skint8 UTSW 4 111936929 missense probably damaging 1.00
R1076:Skint8 UTSW 4 111927219 missense probably damaging 1.00
R1169:Skint8 UTSW 4 111928513 missense possibly damaging 0.86
R1588:Skint8 UTSW 4 111928727 nonsense probably null
R1707:Skint8 UTSW 4 111939572 missense probably damaging 1.00
R1865:Skint8 UTSW 4 111936995 missense probably damaging 1.00
R1954:Skint8 UTSW 4 111950081 missense possibly damaging 0.54
R2896:Skint8 UTSW 4 111950136 missense probably null
R4945:Skint8 UTSW 4 111939608 missense probably damaging 0.96
R5019:Skint8 UTSW 4 111928648 missense probably damaging 0.99
R5281:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5284:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5289:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5309:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5310:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5588:Skint8 UTSW 4 111936892 missense probably benign 0.01
R5636:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5637:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5638:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5639:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5719:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5720:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5754:Skint8 UTSW 4 111950190 missense probably benign
R5850:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R5855:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R6036:Skint8 UTSW 4 111950193 missense probably damaging 0.98
R6525:Skint8 UTSW 4 111928738 missense probably damaging 0.98
R6554:Skint8 UTSW 4 111927216 missense probably benign 0.35
R6578:Skint8 UTSW 4 111936962 missense probably benign 0.03
R6841:Skint8 UTSW 4 111928771 missense probably damaging 1.00
R7000:Skint8 UTSW 4 111937025 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ATGTAATACAGGAGGGTGGTTC -3'
(R):5'- GGGAACTCCATAATGCTTTCTTTTG -3'

Sequencing Primer
(F):5'- GTTCCCAAGGCCCCAAATGG -3'
(R):5'- CTGGAACTCACTCTGTAGATCAGG -3'
Posted On2014-10-01