Incidental Mutation 'R2147:Cep57l1'
ID233926
Institutional Source Beutler Lab
Gene Symbol Cep57l1
Ensembl Gene ENSMUSG00000019813
Gene Namecentrosomal protein 57-like 1
Synonyms4930484D11Rik, 2410017P07Rik
MMRRC Submission 040150-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R2147 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location41718840-41809871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41740899 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 131 (Y131H)
Ref Sequence ENSEMBL: ENSMUSP00000140147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019951] [ENSMUST00000105505] [ENSMUST00000186239] [ENSMUST00000187143] [ENSMUST00000189770] [ENSMUST00000190022] [ENSMUST00000191498]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019951
AA Change: Y131H

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019951
Gene: ENSMUSG00000019813
AA Change: Y131H

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 227 1.2e-64 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Cep57_MT_bd 283 356 2.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105505
AA Change: Y131H

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101144
Gene: ENSMUSG00000019813
AA Change: Y131H

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 223 1.1e-66 PFAM
Pfam:Cep57_MT_bd 252 327 6.8e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000186239
AA Change: Y131H

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139509
Gene: ENSMUSG00000019813
AA Change: Y131H

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 227 2.3e-72 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Cep57_MT_bd 281 356 1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000187143
AA Change: Y131H

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140389
Gene: ENSMUSG00000019813
AA Change: Y131H

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 223 1.1e-66 PFAM
Pfam:Cep57_MT_bd 252 327 6.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189222
Predicted Effect probably damaging
Transcript: ENSMUST00000189770
AA Change: Y131H

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140147
Gene: ENSMUSG00000019813
AA Change: Y131H

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 223 1.1e-66 PFAM
Pfam:Cep57_MT_bd 252 327 6.8e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190022
AA Change: Y55H

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141031
Gene: ENSMUSG00000019813
AA Change: Y55H

DomainStartEndE-ValueType
Pfam:Cep57_CLD 45 151 6.6e-38 PFAM
low complexity region 158 169 N/A INTRINSIC
Pfam:Cep57_MT_bd 205 280 1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191498
AA Change: Y131H

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141089
Gene: ENSMUSG00000019813
AA Change: Y131H

DomainStartEndE-ValueType
Pfam:Cep57_CLD 50 229 1.9e-65 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,571 D647G probably benign Het
4930523C07Rik T A 1: 160,075,433 M91K probably benign Het
Abr T C 11: 76,455,648 R437G probably damaging Het
Acaca T G 11: 84,276,536 D1045E probably benign Het
Adam23 A T 1: 63,534,362 probably null Het
Adam34 A G 8: 43,652,501 Y36H probably benign Het
Alg11 G A 8: 22,065,293 G108D probably damaging Het
Alox12e A T 11: 70,319,945 I316N probably damaging Het
Arid1a A T 4: 133,681,366 F1943L unknown Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC035044 T C 6: 128,890,904 probably benign Het
Bcor G A X: 12,057,623 A578V possibly damaging Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccnf A T 17: 24,230,314 probably null Het
Cdadc1 A G 14: 59,597,753 probably null Het
Cfap44 A G 16: 44,451,684 R1267G probably benign Het
Chd3 A T 11: 69,349,028 L1658Q probably benign Het
Chl1 T C 6: 103,715,401 probably null Het
Chpf2 T A 5: 24,592,035 F660I probably damaging Het
Cmas T A 6: 142,771,289 D302E probably benign Het
Cpne3 T A 4: 19,536,562 M233L probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D430042O09Rik T A 7: 125,865,320 H1286Q probably damaging Het
Dennd3 T G 15: 73,523,487 L143R probably damaging Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dock2 A G 11: 34,229,472 probably null Het
Ergic1 A G 17: 26,636,050 probably null Het
Fbxl15 A T 19: 46,329,188 D103V probably damaging Het
Gm4781 C A 10: 100,396,552 noncoding transcript Het
Hpca A G 4: 129,118,485 I86T possibly damaging Het
Lamb3 T C 1: 193,327,904 V275A probably benign Het
Lipe G T 7: 25,388,521 A38E probably benign Het
Lrrk1 A T 7: 66,285,411 probably null Het
Lrsam1 T C 2: 32,945,879 K292R probably damaging Het
Mbtps1 A T 8: 119,538,859 H316Q probably benign Het
Mms22l T A 4: 24,580,063 Y525* probably null Het
Mrps14 T C 1: 160,195,292 L9P possibly damaging Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myo15 A G 11: 60,510,229 D2992G possibly damaging Het
N4bp2 T A 5: 65,809,200 L1327Q probably damaging Het
Nradd A T 9: 110,622,175 F42I probably benign Het
Olfr175-ps1 T A 16: 58,824,479 I77F probably damaging Het
Pank1 T C 19: 34,827,354 H134R probably benign Het
Pcdh7 T A 5: 58,129,116 M1178K possibly damaging Het
Pcnx3 A T 19: 5,667,605 I1084N probably damaging Het
Pdcd11 A G 19: 47,104,752 M490V probably benign Het
Phf2 T C 13: 48,804,689 K950E unknown Het
Pitpnc1 C T 11: 107,212,518 A252T probably damaging Het
Prickle2 A G 6: 92,425,671 L112P probably damaging Het
Prpf8 A G 11: 75,490,531 I231V probably benign Het
Scin T A 12: 40,080,985 M310L probably benign Het
Serpina3m T A 12: 104,389,224 I50N probably benign Het
Skint8 C G 4: 111,937,077 N221K probably damaging Het
Slc22a23 C T 13: 34,183,007 V673M probably benign Het
Slc24a5 A G 2: 125,087,441 D368G probably damaging Het
Slc28a1 A T 7: 81,126,267 Q237L possibly damaging Het
Smchd1 T A 17: 71,398,588 K1005N possibly damaging Het
Stim2 T C 5: 54,105,375 Y320H probably damaging Het
Syne3 T A 12: 104,953,098 D512V probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Tcp10a T C 17: 7,334,302 S216P probably damaging Het
Tmem178b A T 6: 40,207,501 Q111L probably damaging Het
Tmem236 A G 2: 14,219,050 I217V probably benign Het
Tmem45b A G 9: 31,428,981 V128A probably benign Het
Tnfaip2 T C 12: 111,446,022 Y286H probably damaging Het
Tsc2 T A 17: 24,621,142 I427L possibly damaging Het
Ttc17 T A 2: 94,301,794 N1180I possibly damaging Het
Ubr1 T G 2: 120,864,330 D1707A probably damaging Het
Vmn1r11 A G 6: 57,137,598 I82M probably benign Het
Vmn2r-ps159 T C 4: 156,334,719 noncoding transcript Het
Vps41 G T 13: 18,839,734 probably null Het
Wdr66 T C 5: 123,256,191 V381A probably benign Het
Wnt5a A G 14: 28,513,317 Y86C probably damaging Het
Zfp629 T C 7: 127,610,444 H731R probably damaging Het
Zfp712 T C 13: 67,041,896 E189G possibly damaging Het
Other mutations in Cep57l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Cep57l1 APN 10 41721551 intron probably benign
IGL00679:Cep57l1 APN 10 41719800 nonsense probably null
IGL00839:Cep57l1 APN 10 41731093 missense probably damaging 1.00
IGL01013:Cep57l1 APN 10 41740869 nonsense probably null
IGL01479:Cep57l1 APN 10 41728639 missense possibly damaging 0.95
IGL01830:Cep57l1 APN 10 41728653 missense probably benign 0.03
IGL02005:Cep57l1 APN 10 41740961 missense probably benign 0.39
IGL02679:Cep57l1 APN 10 41729386 missense probably damaging 1.00
IGL02697:Cep57l1 APN 10 41722954 missense possibly damaging 0.83
IGL03328:Cep57l1 APN 10 41743152 missense probably damaging 1.00
R3712:Cep57l1 UTSW 10 41743114 missense probably damaging 1.00
R4049:Cep57l1 UTSW 10 41729360 missense probably damaging 1.00
R4050:Cep57l1 UTSW 10 41729360 missense probably damaging 1.00
R4661:Cep57l1 UTSW 10 41719771 missense possibly damaging 0.91
R4764:Cep57l1 UTSW 10 41721682 missense possibly damaging 0.81
R4929:Cep57l1 UTSW 10 41745914 missense possibly damaging 0.93
R6058:Cep57l1 UTSW 10 41740922 missense possibly damaging 0.87
R6386:Cep57l1 UTSW 10 41743132 missense probably damaging 1.00
R6788:Cep57l1 UTSW 10 41743149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAGAGTCTACCATTGCTGTAG -3'
(R):5'- TTGCACCACGTGTATAACAAC -3'

Sequencing Primer
(F):5'- GCTGTAGGTGACAATCTCCTAGAC -3'
(R):5'- TGTATAACAACACATACCATGCAC -3'
Posted On2014-10-01