Incidental Mutation 'R2147:Wnt5a'
ID233948
Institutional Source Beutler Lab
Gene Symbol Wnt5a
Ensembl Gene ENSMUSG00000021994
Gene Namewingless-type MMTV integration site family, member 5A
Synonyms8030457G12Rik, Wnt-5a
MMRRC Submission 040150-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2147 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location28504750-28527448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28513317 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 86 (Y86C)
Ref Sequence ENSEMBL: ENSMUSP00000107891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063465] [ENSMUST00000112272]
Predicted Effect probably damaging
Transcript: ENSMUST00000063465
AA Change: Y106C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064878
Gene: ENSMUSG00000021994
AA Change: Y106C

DomainStartEndE-ValueType
Blast:WNT1 1 46 7e-6 BLAST
WNT1 71 380 6.71e-222 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112272
AA Change: Y86C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107891
Gene: ENSMUSG00000021994
AA Change: Y86C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WNT1 51 360 6.71e-222 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146192
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180668
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene encodes a member of the WNT family that signals through both the canonical and non-canonical WNT pathways. This protein is a ligand for the seven transmembrane receptor frizzled-5 and the tyrosine kinase orphan receptor 2. This protein plays an essential role in regulating developmental pathways during embryogenesis. This protein may also play a role in oncogenesis. Mutations in this gene are the cause of autosomal dominant Robinow syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous mutants exhibit caudal truncation with shortened anterior-posterior axis, truncation of the snout, tongue and mandible, short fore- and hindlimbs, which lack digits, absent genital tubercle and lung abnormalities. Mutants die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,571 D647G probably benign Het
4930523C07Rik T A 1: 160,075,433 M91K probably benign Het
Abr T C 11: 76,455,648 R437G probably damaging Het
Acaca T G 11: 84,276,536 D1045E probably benign Het
Adam23 A T 1: 63,534,362 probably null Het
Adam34 A G 8: 43,652,501 Y36H probably benign Het
Alg11 G A 8: 22,065,293 G108D probably damaging Het
Alox12e A T 11: 70,319,945 I316N probably damaging Het
Arid1a A T 4: 133,681,366 F1943L unknown Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC035044 T C 6: 128,890,904 probably benign Het
Bcor G A X: 12,057,623 A578V possibly damaging Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccnf A T 17: 24,230,314 probably null Het
Cdadc1 A G 14: 59,597,753 probably null Het
Cep57l1 A G 10: 41,740,899 Y131H probably damaging Het
Cfap44 A G 16: 44,451,684 R1267G probably benign Het
Chd3 A T 11: 69,349,028 L1658Q probably benign Het
Chl1 T C 6: 103,715,401 probably null Het
Chpf2 T A 5: 24,592,035 F660I probably damaging Het
Cmas T A 6: 142,771,289 D302E probably benign Het
Cpne3 T A 4: 19,536,562 M233L probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D430042O09Rik T A 7: 125,865,320 H1286Q probably damaging Het
Dennd3 T G 15: 73,523,487 L143R probably damaging Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dock2 A G 11: 34,229,472 probably null Het
Ergic1 A G 17: 26,636,050 probably null Het
Fbxl15 A T 19: 46,329,188 D103V probably damaging Het
Gm4781 C A 10: 100,396,552 noncoding transcript Het
Hpca A G 4: 129,118,485 I86T possibly damaging Het
Lamb3 T C 1: 193,327,904 V275A probably benign Het
Lipe G T 7: 25,388,521 A38E probably benign Het
Lrrk1 A T 7: 66,285,411 probably null Het
Lrsam1 T C 2: 32,945,879 K292R probably damaging Het
Mbtps1 A T 8: 119,538,859 H316Q probably benign Het
Mms22l T A 4: 24,580,063 Y525* probably null Het
Mrps14 T C 1: 160,195,292 L9P possibly damaging Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myo15 A G 11: 60,510,229 D2992G possibly damaging Het
N4bp2 T A 5: 65,809,200 L1327Q probably damaging Het
Nradd A T 9: 110,622,175 F42I probably benign Het
Olfr175-ps1 T A 16: 58,824,479 I77F probably damaging Het
Pank1 T C 19: 34,827,354 H134R probably benign Het
Pcdh7 T A 5: 58,129,116 M1178K possibly damaging Het
Pcnx3 A T 19: 5,667,605 I1084N probably damaging Het
Pdcd11 A G 19: 47,104,752 M490V probably benign Het
Phf2 T C 13: 48,804,689 K950E unknown Het
Pitpnc1 C T 11: 107,212,518 A252T probably damaging Het
Prickle2 A G 6: 92,425,671 L112P probably damaging Het
Prpf8 A G 11: 75,490,531 I231V probably benign Het
Scin T A 12: 40,080,985 M310L probably benign Het
Serpina3m T A 12: 104,389,224 I50N probably benign Het
Skint8 C G 4: 111,937,077 N221K probably damaging Het
Slc22a23 C T 13: 34,183,007 V673M probably benign Het
Slc24a5 A G 2: 125,087,441 D368G probably damaging Het
Slc28a1 A T 7: 81,126,267 Q237L possibly damaging Het
Smchd1 T A 17: 71,398,588 K1005N possibly damaging Het
Stim2 T C 5: 54,105,375 Y320H probably damaging Het
Syne3 T A 12: 104,953,098 D512V probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Tcp10a T C 17: 7,334,302 S216P probably damaging Het
Tmem178b A T 6: 40,207,501 Q111L probably damaging Het
Tmem236 A G 2: 14,219,050 I217V probably benign Het
Tmem45b A G 9: 31,428,981 V128A probably benign Het
Tnfaip2 T C 12: 111,446,022 Y286H probably damaging Het
Tsc2 T A 17: 24,621,142 I427L possibly damaging Het
Ttc17 T A 2: 94,301,794 N1180I possibly damaging Het
Ubr1 T G 2: 120,864,330 D1707A probably damaging Het
Vmn1r11 A G 6: 57,137,598 I82M probably benign Het
Vmn2r-ps159 T C 4: 156,334,719 noncoding transcript Het
Vps41 G T 13: 18,839,734 probably null Het
Wdr66 T C 5: 123,256,191 V381A probably benign Het
Zfp629 T C 7: 127,610,444 H731R probably damaging Het
Zfp712 T C 13: 67,041,896 E189G possibly damaging Het
Other mutations in Wnt5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Wnt5a APN 14 28522909 missense probably damaging 1.00
IGL01945:Wnt5a APN 14 28518562 missense probably damaging 1.00
IGL02117:Wnt5a APN 14 28506120 splice site probably benign
IGL02995:Wnt5a APN 14 28522914 missense probably benign 0.02
IGL03123:Wnt5a APN 14 28522925 missense probably damaging 1.00
Thrush UTSW 14 28518463 missense possibly damaging 0.78
R0254:Wnt5a UTSW 14 28522854 missense probably damaging 1.00
R0277:Wnt5a UTSW 14 28513268 missense possibly damaging 0.74
R0365:Wnt5a UTSW 14 28518504 nonsense probably null
R1472:Wnt5a UTSW 14 28518504 nonsense probably null
R1661:Wnt5a UTSW 14 28518343 missense probably benign 0.02
R1662:Wnt5a UTSW 14 28518343 missense probably benign 0.02
R1762:Wnt5a UTSW 14 28522891 missense probably damaging 1.00
R1791:Wnt5a UTSW 14 28511878 start codon destroyed probably null 0.00
R1933:Wnt5a UTSW 14 28511845 missense probably benign 0.00
R2149:Wnt5a UTSW 14 28513317 missense probably damaging 1.00
R3078:Wnt5a UTSW 14 28513183 nonsense probably null
R3162:Wnt5a UTSW 14 28522488 missense probably benign 0.00
R3162:Wnt5a UTSW 14 28522488 missense probably benign 0.00
R4237:Wnt5a UTSW 14 28522866 missense probably damaging 1.00
R5396:Wnt5a UTSW 14 28522770 missense probably damaging 1.00
R6329:Wnt5a UTSW 14 28518492 nonsense probably null
R6698:Wnt5a UTSW 14 28518463 missense possibly damaging 0.78
R6974:Wnt5a UTSW 14 28522570 missense possibly damaging 0.89
R7114:Wnt5a UTSW 14 28522756 missense probably damaging 1.00
T0722:Wnt5a UTSW 14 28511925 missense probably benign 0.01
Z1088:Wnt5a UTSW 14 28522728 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGAGCTACCTCTAGAGTTCAC -3'
(R):5'- CATCACCCAGGCTGTAAAGC -3'

Sequencing Primer
(F):5'- TGCAGGTCTCTAGGTATGAATAACCC -3'
(R):5'- GCAGACAGCTCATCAAACATTG -3'
Posted On2014-10-01