Incidental Mutation 'R2147:Pank1'
ID233965
Institutional Source Beutler Lab
Gene Symbol Pank1
Ensembl Gene ENSMUSG00000033610
Gene Namepantothenate kinase 1
SynonymsPank1a, Pank1, 4632412I06Rik, Pank1b, 5430426F23Rik
MMRRC Submission 040150-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R2147 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location34810894-34879455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34827354 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 134 (H134R)
Ref Sequence ENSEMBL: ENSMUSP00000108079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036584] [ENSMUST00000112460]
Predicted Effect probably benign
Transcript: ENSMUST00000036584
AA Change: H309R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000043562
Gene: ENSMUSG00000033610
AA Change: H309R

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 135 147 N/A INTRINSIC
Pfam:Fumble 188 540 1.6e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112460
AA Change: H134R

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108079
Gene: ENSMUSG00000033610
AA Change: H134R

DomainStartEndE-ValueType
Pfam:Fumble 13 365 3.8e-122 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pantothenate kinase family. Pantothenate kinases are key regulatory enzymes in the biosynthesis of coenzyme A (CoA). The encoded protein catalyzes the first and rate-limiting enzymatic reaction in CoA biosynthesis and is regulated by CoA through feedback inhibition. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. This gene and an intronic miRNA on the same strand are co-regulated by the tumor suppressor p53 (see PMID 20833636). [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutant has increased body weight, polyphagia, decreased serum triglyceride and glucose levels after fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,571 D647G probably benign Het
4930523C07Rik T A 1: 160,075,433 M91K probably benign Het
Abr T C 11: 76,455,648 R437G probably damaging Het
Acaca T G 11: 84,276,536 D1045E probably benign Het
Adam23 A T 1: 63,534,362 probably null Het
Adam34 A G 8: 43,652,501 Y36H probably benign Het
Alg11 G A 8: 22,065,293 G108D probably damaging Het
Alox12e A T 11: 70,319,945 I316N probably damaging Het
Arid1a A T 4: 133,681,366 F1943L unknown Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC035044 T C 6: 128,890,904 probably benign Het
Bcor G A X: 12,057,623 A578V possibly damaging Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccnf A T 17: 24,230,314 probably null Het
Cdadc1 A G 14: 59,597,753 probably null Het
Cep57l1 A G 10: 41,740,899 Y131H probably damaging Het
Cfap44 A G 16: 44,451,684 R1267G probably benign Het
Chd3 A T 11: 69,349,028 L1658Q probably benign Het
Chl1 T C 6: 103,715,401 probably null Het
Chpf2 T A 5: 24,592,035 F660I probably damaging Het
Cmas T A 6: 142,771,289 D302E probably benign Het
Cpne3 T A 4: 19,536,562 M233L probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D430042O09Rik T A 7: 125,865,320 H1286Q probably damaging Het
Dennd3 T G 15: 73,523,487 L143R probably damaging Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dock2 A G 11: 34,229,472 probably null Het
Ergic1 A G 17: 26,636,050 probably null Het
Fbxl15 A T 19: 46,329,188 D103V probably damaging Het
Gm4781 C A 10: 100,396,552 noncoding transcript Het
Hpca A G 4: 129,118,485 I86T possibly damaging Het
Lamb3 T C 1: 193,327,904 V275A probably benign Het
Lipe G T 7: 25,388,521 A38E probably benign Het
Lrrk1 A T 7: 66,285,411 probably null Het
Lrsam1 T C 2: 32,945,879 K292R probably damaging Het
Mbtps1 A T 8: 119,538,859 H316Q probably benign Het
Mms22l T A 4: 24,580,063 Y525* probably null Het
Mrps14 T C 1: 160,195,292 L9P possibly damaging Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myo15 A G 11: 60,510,229 D2992G possibly damaging Het
N4bp2 T A 5: 65,809,200 L1327Q probably damaging Het
Nradd A T 9: 110,622,175 F42I probably benign Het
Olfr175-ps1 T A 16: 58,824,479 I77F probably damaging Het
Pcdh7 T A 5: 58,129,116 M1178K possibly damaging Het
Pcnx3 A T 19: 5,667,605 I1084N probably damaging Het
Pdcd11 A G 19: 47,104,752 M490V probably benign Het
Phf2 T C 13: 48,804,689 K950E unknown Het
Pitpnc1 C T 11: 107,212,518 A252T probably damaging Het
Prickle2 A G 6: 92,425,671 L112P probably damaging Het
Prpf8 A G 11: 75,490,531 I231V probably benign Het
Scin T A 12: 40,080,985 M310L probably benign Het
Serpina3m T A 12: 104,389,224 I50N probably benign Het
Skint8 C G 4: 111,937,077 N221K probably damaging Het
Slc22a23 C T 13: 34,183,007 V673M probably benign Het
Slc24a5 A G 2: 125,087,441 D368G probably damaging Het
Slc28a1 A T 7: 81,126,267 Q237L possibly damaging Het
Smchd1 T A 17: 71,398,588 K1005N possibly damaging Het
Stim2 T C 5: 54,105,375 Y320H probably damaging Het
Syne3 T A 12: 104,953,098 D512V probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Tcp10a T C 17: 7,334,302 S216P probably damaging Het
Tmem178b A T 6: 40,207,501 Q111L probably damaging Het
Tmem236 A G 2: 14,219,050 I217V probably benign Het
Tmem45b A G 9: 31,428,981 V128A probably benign Het
Tnfaip2 T C 12: 111,446,022 Y286H probably damaging Het
Tsc2 T A 17: 24,621,142 I427L possibly damaging Het
Ttc17 T A 2: 94,301,794 N1180I possibly damaging Het
Ubr1 T G 2: 120,864,330 D1707A probably damaging Het
Vmn1r11 A G 6: 57,137,598 I82M probably benign Het
Vmn2r-ps159 T C 4: 156,334,719 noncoding transcript Het
Vps41 G T 13: 18,839,734 probably null Het
Wdr66 T C 5: 123,256,191 V381A probably benign Het
Wnt5a A G 14: 28,513,317 Y86C probably damaging Het
Zfp629 T C 7: 127,610,444 H731R probably damaging Het
Zfp712 T C 13: 67,041,896 E189G possibly damaging Het
Other mutations in Pank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:Pank1 APN 19 34840852 missense probably damaging 1.00
IGL02266:Pank1 APN 19 34813686 splice site probably benign
IGL02814:Pank1 APN 19 34840855 missense probably damaging 1.00
IGL03029:Pank1 APN 19 34821135 missense probably damaging 0.96
R0388:Pank1 UTSW 19 34821706 splice site probably benign
R1254:Pank1 UTSW 19 34840860 missense probably benign 0.16
R1820:Pank1 UTSW 19 34877684 critical splice donor site probably null
R1928:Pank1 UTSW 19 34878881 missense probably benign
R2117:Pank1 UTSW 19 34841086 missense probably damaging 1.00
R2141:Pank1 UTSW 19 34878980 missense possibly damaging 0.91
R2226:Pank1 UTSW 19 34827363 missense probably damaging 1.00
R4363:Pank1 UTSW 19 34827132 missense probably damaging 1.00
R4376:Pank1 UTSW 19 34877704 missense probably benign
R5081:Pank1 UTSW 19 34878916 missense probably benign
R5172:Pank1 UTSW 19 34840802 nonsense probably null
R6706:Pank1 UTSW 19 34812386 missense probably damaging 1.00
R6811:Pank1 UTSW 19 34841022 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TGAGCCCATGTTAACCAGC -3'
(R):5'- AGTGCTTTCCCGACAACCAG -3'

Sequencing Primer
(F):5'- CAACATAGGGTACGGGTTATCC -3'
(R):5'- AACCAGGCAGCTCTTGTC -3'
Posted On2014-10-01