Incidental Mutation 'R2148:Fbxl4'
ID233990
Institutional Source Beutler Lab
Gene Symbol Fbxl4
Ensembl Gene ENSMUSG00000040410
Gene NameF-box and leucine-rich repeat protein 4
SynonymsFBL5, FBL4
MMRRC Submission 040151-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R2148 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location22357543-22434091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22427333 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 525 (F525L)
Ref Sequence ENSEMBL: ENSMUSP00000042219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039234] [ENSMUST00000184455] [ENSMUST00000184582] [ENSMUST00000185029]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039234
AA Change: F525L

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000042219
Gene: ENSMUSG00000040410
AA Change: F525L

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-6 BLAST
LRR 400 425 1.95e-3 SMART
LRR 450 475 1.01e-1 SMART
LRR_CC 478 503 4.14e-7 SMART
LRR 504 524 1.16e2 SMART
LRR 532 557 3.69e1 SMART
LRR 558 583 8.71e0 SMART
LRR 584 609 1.64e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184455
Predicted Effect probably benign
Transcript: ENSMUST00000184582
AA Change: F525L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000139158
Gene: ENSMUSG00000040410
AA Change: F525L

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-6 BLAST
LRR 400 425 1.95e-3 SMART
LRR 450 475 1.01e-1 SMART
LRR_CC 478 503 4.14e-7 SMART
LRR 504 524 1.16e2 SMART
LRR 532 557 3.69e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185029
SMART Domains Protein: ENSMUSP00000138825
Gene: ENSMUSG00000040410

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-7 BLAST
Blast:LRR 400 425 2e-9 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, which are characterized by an approximately 40 amino acid motif, the F-box. F-box proteins constitute one subunit of modular E3 ubiquitin ligase complexes, called SCF complexes, which function in phosphorylation-dependent ubiquitination. The F-box domain mediates protein-protein interactions and binds directly to S-phase kinase-associated protein 1. In addition to an F-box domain, the encoded protein contains at least 9 tandem leucine-rich repeats. The ubiquitin ligase complex containing the encoded protein may function in cell-cycle control by regulating levels of lysine-specific demethylase 4A. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik T A 1: 134,390,513 M341K probably damaging Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Abca13 A G 11: 9,615,764 Y4796C probably damaging Het
Actn2 A T 13: 12,300,949 M228K probably damaging Het
Agbl1 T G 7: 76,414,717 probably null Het
Ahi1 T G 10: 20,970,976 V435G possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap6 A G X: 168,796,500 T94A probably benign Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
Bcor G A X: 12,057,623 A578V possibly damaging Het
Bop1 A G 15: 76,455,287 V286A probably damaging Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cacna1a A T 8: 84,629,675 Q1887L possibly damaging Het
Cadps2 G T 6: 23,838,999 probably benign Het
Chl1 T C 6: 103,715,401 probably null Het
Cnot2 A G 10: 116,506,280 I173T probably benign Het
Cntnap5b T A 1: 100,383,474 I564N probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dgkd T G 1: 87,881,921 N110K probably damaging Het
Dhx8 A T 11: 101,738,377 R198* probably null Het
Dnah8 A T 17: 30,737,258 I2071F probably damaging Het
Dsc3 C T 18: 19,965,638 R828Q probably damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gpatch1 A G 7: 35,299,276 V343A probably benign Het
Gpr139 A G 7: 119,144,969 V131A probably benign Het
Hamp T C 7: 30,942,712 T34A possibly damaging Het
Homer2 T G 7: 81,624,295 D51A possibly damaging Het
Hspa1l C T 17: 34,977,390 A135V probably damaging Het
Igsf10 A G 3: 59,336,577 M112T possibly damaging Het
Ikbkb A T 8: 22,682,745 L153Q probably damaging Het
Kif19a A T 11: 114,780,768 I158F probably damaging Het
L1cam A T X: 73,861,141 F536Y probably damaging Het
Lamb3 T C 1: 193,327,904 V275A probably benign Het
Lhx1 A T 11: 84,519,821 S226T probably benign Het
Llcfc1 G A 6: 41,685,221 G53D possibly damaging Het
Loxl4 A G 19: 42,604,192 probably null Het
Magee1 A T X: 105,122,958 D783V probably damaging Het
Mak T C 13: 41,042,037 K400R probably benign Het
Mgat4c T C 10: 102,388,929 F335L probably benign Het
Mospd2 A G X: 164,956,477 probably null Het
Mtor T C 4: 148,456,012 F245L possibly damaging Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myo5a T A 9: 75,180,147 L1095H probably damaging Het
Nlrp1a T A 11: 71,122,907 K506* probably null Het
Olfr73 C A 2: 88,034,599 C180F probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pet2 T C X: 89,406,277 D82G possibly damaging Het
Phkb A G 8: 86,017,486 D588G probably damaging Het
Pkd1l2 A T 8: 117,056,325 I752N probably damaging Het
Pkhd1 C A 1: 20,414,220 probably null Het
Plod3 C T 5: 136,987,773 R30* probably null Het
Ppfia4 T C 1: 134,312,634 I591V probably benign Het
Prickle2 A G 6: 92,425,671 L112P probably damaging Het
Ptgs2 G T 1: 150,105,714 A583S probably benign Het
Pycr2 T C 1: 180,906,848 V231A probably damaging Het
Ralgapa2 T C 2: 146,431,887 D540G probably benign Het
Rasal1 T A 5: 120,662,031 I150N probably damaging Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Sacs T C 14: 61,173,378 L34P probably damaging Het
Sema3d A G 5: 12,484,959 Y106C probably damaging Het
Serpinb8 T A 1: 107,605,927 D237E probably benign Het
Slc19a2 T C 1: 164,262,088 W158R probably damaging Het
Sorbs1 A T 19: 40,376,824 F172I possibly damaging Het
Spaca7 A T 8: 12,586,447 D91V probably damaging Het
Tead3 A G 17: 28,333,664 F187L probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tmem132c T A 5: 127,462,962 W351R probably damaging Het
Tmem178b A T 6: 40,207,501 Q111L probably damaging Het
Trap1 T C 16: 4,060,760 D236G probably damaging Het
Trim45 T A 3: 100,932,044 L754* probably null Het
Tubgcp5 A G 7: 55,799,511 E152G probably damaging Het
Uaca A T 9: 60,869,679 L447F probably damaging Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Wdr11 A G 7: 129,629,083 probably null Het
Zfp462 T A 4: 55,013,670 S1879T probably benign Het
Zfr2 T G 10: 81,242,116 V259G probably benign Het
Other mutations in Fbxl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Fbxl4 APN 4 22427348 missense probably benign 0.01
IGL01973:Fbxl4 APN 4 22422766 missense probably damaging 1.00
IGL02353:Fbxl4 APN 4 22433684 missense probably benign 0.00
IGL02360:Fbxl4 APN 4 22433684 missense probably benign 0.00
IGL02871:Fbxl4 APN 4 22386213 missense probably benign
R0033:Fbxl4 UTSW 4 22377017 missense probably damaging 1.00
R0379:Fbxl4 UTSW 4 22386106 missense probably benign 0.01
R1053:Fbxl4 UTSW 4 22427166 missense probably benign
R1527:Fbxl4 UTSW 4 22386154 missense probably benign 0.00
R1768:Fbxl4 UTSW 4 22385950 missense probably benign 0.00
R2196:Fbxl4 UTSW 4 22403624 missense probably benign
R2850:Fbxl4 UTSW 4 22403624 missense probably benign
R4024:Fbxl4 UTSW 4 22377074 missense possibly damaging 0.83
R4425:Fbxl4 UTSW 4 22422699 intron probably null
R5227:Fbxl4 UTSW 4 22376840 missense probably damaging 1.00
R5499:Fbxl4 UTSW 4 22386017 missense probably damaging 1.00
R5595:Fbxl4 UTSW 4 22433641 missense probably damaging 1.00
R5895:Fbxl4 UTSW 4 22390678 missense probably damaging 1.00
R6475:Fbxl4 UTSW 4 22433661 missense probably damaging 1.00
R6697:Fbxl4 UTSW 4 22376599 missense probably benign 0.33
R6977:Fbxl4 UTSW 4 22376930 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TCTGTCTGTGACATGTAGAACTTGG -3'
(R):5'- CGCCATCATTTTGTATGCAAAC -3'

Sequencing Primer
(F):5'- GAACTTGGAACTATTTGCTTTCCAG -3'
(R):5'- CCAGTTGCTGTAATCTGGT -3'
Posted On2014-10-01