Incidental Mutation 'R0195:Itpr3'
ID23400
Institutional Source Beutler Lab
Gene Symbol Itpr3
Ensembl Gene ENSMUSG00000042644
Gene Nameinositol 1,4,5-triphosphate receptor 3
Synonymstf, Ip3r3, Itpr-3
MMRRC Submission 038454-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0195 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location27057304-27122223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27114114 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1900 (Y1900C)
Ref Sequence ENSEMBL: ENSMUSP00000038150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049308]
PDB Structure
Crystal structure of the ligand binding suppressor domain of type 3 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000049308
AA Change: Y1900C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644
AA Change: Y1900C

DomainStartEndE-ValueType
MIR 113 167 7.75e-6 SMART
MIR 174 224 1.16e-4 SMART
MIR 232 288 1.21e-7 SMART
MIR 295 402 9.38e-14 SMART
Pfam:RYDR_ITPR 473 670 7.8e-64 PFAM
low complexity region 881 889 N/A INTRINSIC
Pfam:RYDR_ITPR 1175 1333 5.8e-16 PFAM
low complexity region 1549 1567 N/A INTRINSIC
low complexity region 1831 1851 N/A INTRINSIC
Pfam:RIH_assoc 1863 1973 2.6e-34 PFAM
transmembrane domain 2203 2225 N/A INTRINSIC
Pfam:Ion_trans 2235 2527 8.1e-20 PFAM
coiled coil region 2631 2660 N/A INTRINSIC
Meta Mutation Damage Score 0.66 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.4%
Validation Efficiency 98% (156/160)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C G 11: 100,512,974 R362P possibly damaging Het
Adam24 T A 8: 40,681,766 W758R probably benign Het
Adam26b G T 8: 43,520,270 T565K probably damaging Het
Adam7 T G 14: 68,527,627 probably benign Het
Adamts19 A G 18: 58,969,870 probably benign Het
Add1 A G 5: 34,610,646 probably benign Het
Ago1 A G 4: 126,463,691 C64R probably benign Het
Ankrd12 C T 17: 66,049,948 probably null Het
Arhgef33 A G 17: 80,381,434 K820E probably damaging Het
Arl9 T C 5: 77,006,494 V8A probably damaging Het
Aspm T C 1: 139,479,135 L1920P probably damaging Het
Atad2 A G 15: 58,099,954 probably benign Het
Atp2b2 A T 6: 113,793,874 V358E probably benign Het
C3ar1 A C 6: 122,851,155 C34W possibly damaging Het
C6 G A 15: 4,763,471 V353M probably benign Het
Capn7 T C 14: 31,365,581 I593T probably damaging Het
Casc3 T A 11: 98,821,493 D119E probably damaging Het
Ccna1 T A 3: 55,054,364 E45V probably damaging Het
Cdc37 A G 9: 21,142,280 V180A probably benign Het
Cdh23 A G 10: 60,317,059 I2393T probably damaging Het
Cnbd1 T C 4: 18,906,988 probably benign Het
Cngb3 A T 4: 19,280,975 M15L probably benign Het
Crygn A G 5: 24,756,038 M90T possibly damaging Het
Cse1l T A 2: 166,940,088 S661R probably benign Het
D830013O20Rik C T 12: 73,364,321 noncoding transcript Het
Ddx24 C T 12: 103,418,961 probably null Het
Dnah3 A T 7: 120,077,775 probably null Het
Dnah9 C T 11: 65,895,905 G3634E probably benign Het
Dnttip2 A T 3: 122,276,161 T342S probably benign Het
Evx2 G T 2: 74,659,044 R125S probably damaging Het
Fbxl5 A T 5: 43,770,798 L40Q probably damaging Het
Git1 T A 11: 77,501,073 D240E probably benign Het
Glp2r T A 11: 67,709,708 K438N probably damaging Het
Gm4778 A G 3: 94,265,922 Y79C possibly damaging Het
Hivep1 T A 13: 42,156,153 I623N probably benign Het
Il17re A G 6: 113,466,137 E312G probably damaging Het
Itgb7 G A 15: 102,222,183 probably benign Het
Krt2 G A 15: 101,813,191 Q472* probably null Het
Krtap5-1 A C 7: 142,296,697 C125G unknown Het
Macf1 A G 4: 123,434,916 S2554P probably damaging Het
March10 C T 11: 105,385,525 G646R probably damaging Het
Mrpl48 A C 7: 100,546,353 probably benign Het
Myo16 A T 8: 10,315,538 probably benign Het
Nrcam A T 12: 44,584,845 E1060D probably benign Het
Nsd3 T A 8: 25,680,693 C731S probably damaging Het
Nup85 T G 11: 115,564,531 M1R probably null Het
Nxnl2 G T 13: 51,171,447 R42L probably damaging Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Orc1 C T 4: 108,614,308 R786* probably null Het
P2ry6 A T 7: 100,938,697 W152R probably damaging Het
Pex5l T C 3: 32,992,953 N283D possibly damaging Het
Pgk2 T C 17: 40,207,731 I269V probably benign Het
Phgdh T G 3: 98,316,550 probably benign Het
Pzp A T 6: 128,487,478 L1362Q probably damaging Het
Rbbp9 T C 2: 144,548,106 probably benign Het
Rffl A G 11: 82,810,163 L244P probably damaging Het
Serpina11 T C 12: 103,985,872 Y213C probably damaging Het
Srsf11 A G 3: 158,036,535 probably benign Het
Sspo T A 6: 48,486,636 V3785E probably benign Het
Svep1 A T 4: 58,089,514 S1632T possibly damaging Het
Tm4sf1 T A 3: 57,293,059 D74V probably damaging Het
Tmprss15 T A 16: 79,034,334 T393S probably benign Het
Tnfaip3 A G 10: 19,005,713 L275P probably damaging Het
Trim30c A G 7: 104,382,429 V393A probably benign Het
Tssk2 T A 16: 17,899,575 S281T probably benign Het
Tubb4a A G 17: 57,081,499 S176P probably damaging Het
Unc45b T A 11: 82,937,828 M785K probably damaging Het
Vldlr A T 19: 27,238,386 D261V probably damaging Het
Vmn1r176 G T 7: 23,835,585 Q48K probably benign Het
Vmn2r110 A T 17: 20,574,055 L784Q probably benign Het
Vps13b A G 15: 35,471,899 T783A probably benign Het
Zfp800 A G 6: 28,243,847 M373T probably damaging Het
Zmym1 A G 4: 127,047,911 F895L possibly damaging Het
Other mutations in Itpr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Itpr3 APN 17 27083629 missense probably benign 0.05
IGL00980:Itpr3 APN 17 27110956 missense probably benign
IGL01151:Itpr3 APN 17 27091529 missense probably damaging 1.00
IGL01289:Itpr3 APN 17 27099765 missense probably damaging 0.99
IGL01403:Itpr3 APN 17 27118595 missense probably damaging 0.97
IGL01666:Itpr3 APN 17 27117178 missense probably benign 0.02
IGL01897:Itpr3 APN 17 27111262 missense probably damaging 1.00
IGL02003:Itpr3 APN 17 27121475 missense probably damaging 1.00
IGL02012:Itpr3 APN 17 27104095 missense probably benign
IGL02063:Itpr3 APN 17 27120023 missense probably benign 0.01
IGL02146:Itpr3 APN 17 27117275 missense probably damaging 1.00
IGL02158:Itpr3 APN 17 27098442 missense probably damaging 1.00
IGL02177:Itpr3 APN 17 27099614 missense possibly damaging 0.74
IGL02247:Itpr3 APN 17 27098179 missense probably damaging 1.00
IGL02606:Itpr3 APN 17 27114512 splice site probably benign
IGL02651:Itpr3 APN 17 27106398 missense probably damaging 0.99
IGL02902:Itpr3 APN 17 27104556 missense probably benign 0.21
IGL03001:Itpr3 APN 17 27089612 splice site probably benign
IGL03004:Itpr3 APN 17 27097978 missense possibly damaging 0.90
IGL03065:Itpr3 APN 17 27091933 missense probably damaging 1.00
IGL03117:Itpr3 APN 17 27119266 missense probably damaging 1.00
IGL03181:Itpr3 APN 17 27111268 missense probably benign
IGL03404:Itpr3 APN 17 27091518 missense probably damaging 1.00
alopecia UTSW 17 27095478 missense probably damaging 0.98
beauty UTSW 17 27106342 missense probably damaging 1.00
Opuesto UTSW 17 27087592 missense probably damaging 1.00
paradox UTSW 17 27098171 missense probably damaging 1.00
pulchritude UTSW 17 27086960 missense probably damaging 0.97
R0010:Itpr3 UTSW 17 27120977 missense probably damaging 1.00
R0055:Itpr3 UTSW 17 27098322 missense probably damaging 1.00
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0104:Itpr3 UTSW 17 27095992 missense probably benign 0.01
R0212:Itpr3 UTSW 17 27089319 missense probably damaging 1.00
R0454:Itpr3 UTSW 17 27113819 missense probably benign
R0485:Itpr3 UTSW 17 27111929 missense probably damaging 0.98
R0501:Itpr3 UTSW 17 27107289 missense probably benign 0.09
R0781:Itpr3 UTSW 17 27110555 missense probably benign 0.00
R0890:Itpr3 UTSW 17 27089011 nonsense probably null
R1028:Itpr3 UTSW 17 27091369 missense probably benign 0.04
R1144:Itpr3 UTSW 17 27114923 missense probably benign 0.01
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1458:Itpr3 UTSW 17 27118372 missense probably benign 0.01
R1463:Itpr3 UTSW 17 27117154 splice site probably benign
R1472:Itpr3 UTSW 17 27114225 missense probably benign 0.09
R1529:Itpr3 UTSW 17 27105485 splice site probably null
R1533:Itpr3 UTSW 17 27095560 missense possibly damaging 0.71
R1537:Itpr3 UTSW 17 27114147 missense possibly damaging 0.96
R1618:Itpr3 UTSW 17 27116607 critical splice acceptor site probably null
R1672:Itpr3 UTSW 17 27089013 missense probably benign
R1726:Itpr3 UTSW 17 27111690 missense probably damaging 0.96
R1865:Itpr3 UTSW 17 27120023 missense probably benign 0.01
R1940:Itpr3 UTSW 17 27111217 missense probably damaging 1.00
R2023:Itpr3 UTSW 17 27102811 missense possibly damaging 0.76
R2063:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2064:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2065:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2067:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2068:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2219:Itpr3 UTSW 17 27115053 missense probably benign
R2248:Itpr3 UTSW 17 27115059 missense probably damaging 1.00
R2291:Itpr3 UTSW 17 27113579 missense possibly damaging 0.92
R2320:Itpr3 UTSW 17 27095915 missense probably benign
R2864:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R2865:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R3778:Itpr3 UTSW 17 27095472 missense possibly damaging 0.57
R3881:Itpr3 UTSW 17 27113840 missense probably benign 0.01
R3979:Itpr3 UTSW 17 27085131 missense probably benign 0.23
R3979:Itpr3 UTSW 17 27091572 missense probably damaging 1.00
R4224:Itpr3 UTSW 17 27107258 missense probably damaging 1.00
R4259:Itpr3 UTSW 17 27106324 missense probably damaging 1.00
R4321:Itpr3 UTSW 17 27111974 missense probably benign 0.00
R4466:Itpr3 UTSW 17 27106342 missense probably damaging 1.00
R4493:Itpr3 UTSW 17 27104612 missense probably damaging 1.00
R4597:Itpr3 UTSW 17 27093283 missense probably damaging 1.00
R4823:Itpr3 UTSW 17 27085147 missense probably benign 0.30
R4921:Itpr3 UTSW 17 27098005 missense probably damaging 1.00
R4974:Itpr3 UTSW 17 27083608 missense probably damaging 0.96
R5063:Itpr3 UTSW 17 27089911 missense possibly damaging 0.94
R5079:Itpr3 UTSW 17 27098423 missense probably damaging 1.00
R5303:Itpr3 UTSW 17 27116689 missense probably benign 0.38
R5518:Itpr3 UTSW 17 27087592 missense probably damaging 1.00
R5521:Itpr3 UTSW 17 27107334 missense probably benign 0.09
R5566:Itpr3 UTSW 17 27115952 missense possibly damaging 0.71
R5567:Itpr3 UTSW 17 27103906 missense possibly damaging 0.66
R5579:Itpr3 UTSW 17 27113519 missense probably damaging 1.00
R5610:Itpr3 UTSW 17 27118566 missense probably benign 0.42
R5658:Itpr3 UTSW 17 27107878 missense possibly damaging 0.74
R5856:Itpr3 UTSW 17 27106405 missense probably damaging 1.00
R5872:Itpr3 UTSW 17 27086976 missense probably benign 0.02
R5878:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R5889:Itpr3 UTSW 17 27115065 missense probably damaging 0.99
R5907:Itpr3 UTSW 17 27117893 missense probably damaging 1.00
R5930:Itpr3 UTSW 17 27110921 missense possibly damaging 0.49
R5987:Itpr3 UTSW 17 27104601 missense probably damaging 1.00
R6029:Itpr3 UTSW 17 27098171 missense probably damaging 1.00
R6195:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6213:Itpr3 UTSW 17 27111200 missense probably benign 0.03
R6233:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6376:Itpr3 UTSW 17 27095475 missense possibly damaging 0.94
R6514:Itpr3 UTSW 17 27091370 missense probably benign
R6515:Itpr3 UTSW 17 27091370 missense probably benign
R6516:Itpr3 UTSW 17 27091370 missense probably benign
R6955:Itpr3 UTSW 17 27121467 missense probably damaging 1.00
R7002:Itpr3 UTSW 17 27110580 missense probably benign 0.00
R7064:Itpr3 UTSW 17 27089295 missense probably damaging 1.00
R7257:Itpr3 UTSW 17 27118561 missense probably benign 0.00
V7732:Itpr3 UTSW 17 27111024 splice site probably benign
V7732:Itpr3 UTSW 17 27111026 splice site probably null
Z1088:Itpr3 UTSW 17 27113528 missense possibly damaging 0.50
Z31818:Itpr3 UTSW 17 27095478 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTGAGAACCACAACCGTGACC -3'
(R):5'- ATTGAGGATCAGCGCCGTGATG -3'

Sequencing Primer
(F):5'- AACCGTGACCTGCAAGTG -3'
(R):5'- TCGTGAGTCACAATGCAGGTC -3'
Posted On2013-04-16