Incidental Mutation 'R2148:Lhx1'
ID234033
Institutional Source Beutler Lab
Gene Symbol Lhx1
Ensembl Gene ENSMUSG00000018698
Gene NameLIM homeobox protein 1
SynonymsLim1
MMRRC Submission 040151-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2148 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location84518284-84525535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84519821 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 226 (S226T)
Ref Sequence ENSEMBL: ENSMUSP00000138899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018842] [ENSMUST00000092827] [ENSMUST00000184646]
Predicted Effect probably benign
Transcript: ENSMUST00000018842
AA Change: S317T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000018842
Gene: ENSMUSG00000018698
AA Change: S317T

DomainStartEndE-ValueType
LIM 3 54 5.51e-17 SMART
LIM 62 117 4.24e-18 SMART
low complexity region 137 156 N/A INTRINSIC
HOX 180 242 1.33e-22 SMART
low complexity region 315 327 N/A INTRINSIC
low complexity region 349 367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092827
SMART Domains Protein: ENSMUSP00000090503
Gene: ENSMUSG00000018698

DomainStartEndE-ValueType
LIM 18 73 4.24e-18 SMART
low complexity region 93 112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176503
SMART Domains Protein: ENSMUSP00000135334
Gene: ENSMUSG00000018698

DomainStartEndE-ValueType
Pfam:Homeobox 1 17 5.3e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184646
AA Change: S226T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138899
Gene: ENSMUSG00000018698
AA Change: S226T

DomainStartEndE-ValueType
low complexity region 46 65 N/A INTRINSIC
HOX 89 151 6.8e-25 SMART
low complexity region 224 236 N/A INTRINSIC
low complexity region 258 276 N/A INTRINSIC
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large protein family which contains the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor important for the development of the renal and urogenital systems. This gene is a candidate for Mayer-Rokitansky-Kuster-Hauser syndrome, a disorder characterized by anomalies in the female genital tract. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygotes for targeted null mutations are small, fail to develop head structures anterior to rhombomere 3 in the hindbrain, lack kidneys and gonads, and show aberrant trajectories of limb motor axons. Most mutants die around embryonic day 10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406M09Rik T A 1: 134,390,513 M341K probably damaging Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Abca13 A G 11: 9,615,764 Y4796C probably damaging Het
Actn2 A T 13: 12,300,949 M228K probably damaging Het
Agbl1 T G 7: 76,414,717 probably null Het
Ahi1 T G 10: 20,970,976 V435G possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap6 A G X: 168,796,500 T94A probably benign Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
Bcor G A X: 12,057,623 A578V possibly damaging Het
Bop1 A G 15: 76,455,287 V286A probably damaging Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cacna1a A T 8: 84,629,675 Q1887L possibly damaging Het
Cadps2 G T 6: 23,838,999 probably benign Het
Chl1 T C 6: 103,715,401 probably null Het
Cnot2 A G 10: 116,506,280 I173T probably benign Het
Cntnap5b T A 1: 100,383,474 I564N probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dgkd T G 1: 87,881,921 N110K probably damaging Het
Dhx8 A T 11: 101,738,377 R198* probably null Het
Dnah8 A T 17: 30,737,258 I2071F probably damaging Het
Dsc3 C T 18: 19,965,638 R828Q probably damaging Het
Fbxl4 T C 4: 22,427,333 F525L possibly damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gpatch1 A G 7: 35,299,276 V343A probably benign Het
Gpr139 A G 7: 119,144,969 V131A probably benign Het
Hamp T C 7: 30,942,712 T34A possibly damaging Het
Homer2 T G 7: 81,624,295 D51A possibly damaging Het
Hspa1l C T 17: 34,977,390 A135V probably damaging Het
Igsf10 A G 3: 59,336,577 M112T possibly damaging Het
Ikbkb A T 8: 22,682,745 L153Q probably damaging Het
Kif19a A T 11: 114,780,768 I158F probably damaging Het
L1cam A T X: 73,861,141 F536Y probably damaging Het
Lamb3 T C 1: 193,327,904 V275A probably benign Het
Llcfc1 G A 6: 41,685,221 G53D possibly damaging Het
Loxl4 A G 19: 42,604,192 probably null Het
Magee1 A T X: 105,122,958 D783V probably damaging Het
Mak T C 13: 41,042,037 K400R probably benign Het
Mgat4c T C 10: 102,388,929 F335L probably benign Het
Mospd2 A G X: 164,956,477 probably null Het
Mtor T C 4: 148,456,012 F245L possibly damaging Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myo5a T A 9: 75,180,147 L1095H probably damaging Het
Nlrp1a T A 11: 71,122,907 K506* probably null Het
Olfr73 C A 2: 88,034,599 C180F probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pet2 T C X: 89,406,277 D82G possibly damaging Het
Phkb A G 8: 86,017,486 D588G probably damaging Het
Pkd1l2 A T 8: 117,056,325 I752N probably damaging Het
Pkhd1 C A 1: 20,414,220 probably null Het
Plod3 C T 5: 136,987,773 R30* probably null Het
Ppfia4 T C 1: 134,312,634 I591V probably benign Het
Prickle2 A G 6: 92,425,671 L112P probably damaging Het
Ptgs2 G T 1: 150,105,714 A583S probably benign Het
Pycr2 T C 1: 180,906,848 V231A probably damaging Het
Ralgapa2 T C 2: 146,431,887 D540G probably benign Het
Rasal1 T A 5: 120,662,031 I150N probably damaging Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Sacs T C 14: 61,173,378 L34P probably damaging Het
Sema3d A G 5: 12,484,959 Y106C probably damaging Het
Serpinb8 T A 1: 107,605,927 D237E probably benign Het
Slc19a2 T C 1: 164,262,088 W158R probably damaging Het
Sorbs1 A T 19: 40,376,824 F172I possibly damaging Het
Spaca7 A T 8: 12,586,447 D91V probably damaging Het
Tead3 A G 17: 28,333,664 F187L probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tmem132c T A 5: 127,462,962 W351R probably damaging Het
Tmem178b A T 6: 40,207,501 Q111L probably damaging Het
Trap1 T C 16: 4,060,760 D236G probably damaging Het
Trim45 T A 3: 100,932,044 L754* probably null Het
Tubgcp5 A G 7: 55,799,511 E152G probably damaging Het
Uaca A T 9: 60,869,679 L447F probably damaging Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Wdr11 A G 7: 129,629,083 probably null Het
Zfp462 T A 4: 55,013,670 S1879T probably benign Het
Zfr2 T G 10: 81,242,116 V259G probably benign Het
Other mutations in Lhx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Lhx1 APN 11 84519652 missense probably damaging 0.97
R1346:Lhx1 UTSW 11 84522079 missense possibly damaging 0.55
R1565:Lhx1 UTSW 11 84519821 missense probably benign 0.00
R1806:Lhx1 UTSW 11 84524141 missense probably damaging 1.00
R2449:Lhx1 UTSW 11 84521738 missense probably damaging 1.00
R3721:Lhx1 UTSW 11 84521828 missense probably damaging 1.00
R3793:Lhx1 UTSW 11 84521900 missense probably benign 0.01
R4940:Lhx1 UTSW 11 84519909 nonsense probably null
R5178:Lhx1 UTSW 11 84520388 missense possibly damaging 0.69
R5877:Lhx1 UTSW 11 84522239 missense probably damaging 1.00
R6366:Lhx1 UTSW 11 84522208 missense probably damaging 1.00
R6551:Lhx1 UTSW 11 84521913 missense probably benign 0.23
R7060:Lhx1 UTSW 11 84520282 critical splice donor site probably null
R7106:Lhx1 UTSW 11 84522077 missense probably benign 0.00
R7133:Lhx1 UTSW 11 84519920 missense probably benign 0.00
R7161:Lhx1 UTSW 11 84519872 missense probably damaging 1.00
R7290:Lhx1 UTSW 11 84521877 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAAATGGTTCCCGTAGCTGG -3'
(R):5'- ACTTGTGGGTGCTTCTAGAC -3'

Sequencing Primer
(F):5'- ACCATTGACCGACAGAGATG -3'
(R):5'- CTAGACTCGGGGTTGTGCC -3'
Posted On2014-10-01