Incidental Mutation 'R2149:Abca12'
ID234066
Institutional Source Beutler Lab
Gene Symbol Abca12
Ensembl Gene ENSMUSG00000050296
Gene NameATP-binding cassette, sub-family A (ABC1), member 12
Synonyms4833417A11Rik, 4832428G11Rik
MMRRC Submission 040152-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2149 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location71242276-71414910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 71263488 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 2191 (V2191L)
Ref Sequence ENSEMBL: ENSMUSP00000084523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087268]
Predicted Effect probably benign
Transcript: ENSMUST00000087268
AA Change: V2191L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000084523
Gene: ENSMUSG00000050296
AA Change: V2191L

DomainStartEndE-ValueType
transmembrane domain 24 43 N/A INTRINSIC
low complexity region 246 259 N/A INTRINSIC
Pfam:ABC2_membrane_3 885 1267 2.9e-24 PFAM
AAA 1370 1554 4.2e-10 SMART
low complexity region 1717 1735 N/A INTRINSIC
Pfam:ABC2_membrane_3 1744 2206 9.6e-35 PFAM
AAA 2282 2467 4.61e-7 SMART
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily, which is the only major ABC subfamily found exclusively in multicellular eukaryotes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with defective skin development and abnormal lung morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik A G 1: 43,742,336 D126G probably damaging Het
1700006A11Rik T C 3: 124,409,686 E414G probably benign Het
3632451O06Rik T C 14: 49,751,571 D647G probably benign Het
Abca13 A G 11: 9,267,508 T317A possibly damaging Het
Acap3 T G 4: 155,905,625 L750R probably damaging Het
Anapc7 T A 5: 122,443,826 S511T probably benign Het
Anp32a T A 9: 62,371,802 F46Y probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arid2 T C 15: 96,370,835 I943T probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC003331 A T 1: 150,388,559 N66K probably benign Het
Btnl6 T C 17: 34,514,347 N218S possibly damaging Het
Capn11 T C 17: 45,633,107 probably null Het
Clcnkb C T 4: 141,408,017 G470D probably damaging Het
Clic6 T A 16: 92,499,207 S252T probably benign Het
Col28a1 T C 6: 8,155,383 K318E possibly damaging Het
Col5a3 A T 9: 20,771,270 V1626D unknown Het
Col6a4 C A 9: 106,076,929 A404S probably benign Het
Cyp2j5 G T 4: 96,641,340 H265N possibly damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dock2 A G 11: 34,229,472 probably null Het
Emilin2 T C 17: 71,273,992 S580G probably benign Het
Fbn2 C A 18: 58,102,325 probably null Het
Gfm1 T C 3: 67,474,560 L693P probably damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gpha2 A G 19: 6,226,982 T38A probably damaging Het
Gtf2h3 T C 5: 124,599,785 probably benign Het
Hmgxb3 T C 18: 61,157,674 T376A probably benign Het
Hspa12b A G 2: 131,143,057 D416G probably damaging Het
Immt C T 6: 71,844,675 R28* probably null Het
Iqgap1 T C 7: 80,762,560 Y180C probably damaging Het
Kcnq3 T A 15: 66,023,729 D322V probably damaging Het
Kifc2 C A 15: 76,662,221 L268I probably benign Het
Lama1 T C 17: 67,773,865 M1296T possibly damaging Het
Lipk A G 19: 34,021,617 N104S possibly damaging Het
Lrrc14b T A 13: 74,363,757 N68I possibly damaging Het
Lrrc28 A T 7: 67,531,682 D268E probably damaging Het
Ly6c2 T C 15: 75,108,543 *132W probably null Het
Msh6 A G 17: 87,986,088 E757G probably damaging Het
Mtss1l T C 8: 110,726,383 V47A possibly damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Nalcn A T 14: 123,370,017 I680N probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1501 A C 19: 13,838,582 V197G probably damaging Het
Olfr61 C T 7: 140,638,052 T117M probably damaging Het
Olfr713 A T 7: 107,036,338 Y61F possibly damaging Het
Olfr912 T C 9: 38,581,508 V77A probably benign Het
Oosp2 A T 19: 11,649,614 L17* probably null Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pde4dip T A 3: 97,792,836 Q300L possibly damaging Het
Phf2 T C 13: 48,804,689 K950E unknown Het
Pira2 G A 7: 3,844,171 P124L probably damaging Het
Plpp4 C T 7: 129,379,371 T157I probably benign Het
Polrmt G A 10: 79,740,275 Q545* probably null Het
Ptprs A G 17: 56,417,706 F1511L probably damaging Het
Sbno1 T C 5: 124,402,119 probably null Het
Setd1a T A 7: 127,786,518 V256D possibly damaging Het
Slamf1 T C 1: 171,767,272 S16P probably damaging Het
Slc16a14 T C 1: 84,907,399 D473G probably damaging Het
Slc8a2 A T 7: 16,159,164 H917L probably damaging Het
Sorbs2 A C 8: 45,795,443 D442A probably damaging Het
Srp68 G T 11: 116,260,867 T301K possibly damaging Het
Stab2 A T 10: 86,865,040 C457* probably null Het
Stk31 T G 6: 49,439,218 S652R possibly damaging Het
Stra6 T G 9: 58,152,539 S594R probably benign Het
Tbc1d9 G A 8: 83,271,449 E1212K probably damaging Het
Thada C T 17: 84,441,764 R593Q probably damaging Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tmem132c T A 5: 127,462,962 W351R probably damaging Het
Tmem206 T G 1: 191,345,109 F210V probably benign Het
Trim10 C T 17: 36,877,014 A374V probably benign Het
Try10 T C 6: 41,356,561 V80A probably benign Het
Ttn T C 2: 76,729,363 T29565A possibly damaging Het
Uggt2 G T 14: 119,075,345 Q351K probably benign Het
Vmn1r120 A T 7: 21,052,964 V274D probably damaging Het
Vmn1r62 A T 7: 5,675,359 H13L probably benign Het
Vmn2r101 C T 17: 19,588,963 T118I probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Wnt5a A G 14: 28,513,317 Y86C probably damaging Het
Xpa T C 4: 46,183,189 E200G probably damaging Het
Zc3h12a C T 4: 125,126,642 R136K possibly damaging Het
Zc3hav1 T C 6: 38,336,537 H191R probably damaging Het
Zfp804a A G 2: 82,258,664 T946A probably benign Het
Other mutations in Abca12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca12 APN 1 71303541 missense possibly damaging 0.64
IGL00556:Abca12 APN 1 71353757 missense probably benign 0.00
IGL00813:Abca12 APN 1 71353762 critical splice acceptor site probably null
IGL00835:Abca12 APN 1 71302733 missense probably damaging 1.00
IGL00921:Abca12 APN 1 71285729 missense probably damaging 1.00
IGL01011:Abca12 APN 1 71263632 missense probably benign 0.02
IGL01066:Abca12 APN 1 71353730 missense possibly damaging 0.95
IGL01082:Abca12 APN 1 71314114 missense probably damaging 1.00
IGL01310:Abca12 APN 1 71284156 missense probably benign 0.00
IGL01360:Abca12 APN 1 71286489 missense possibly damaging 0.95
IGL01585:Abca12 APN 1 71319886 missense probably benign 0.00
IGL01608:Abca12 APN 1 71259442 missense probably damaging 1.00
IGL01687:Abca12 APN 1 71267610 splice site probably benign
IGL01700:Abca12 APN 1 71280390 missense probably benign
IGL01723:Abca12 APN 1 71314168 missense probably benign 0.01
IGL01804:Abca12 APN 1 71276183 missense probably benign 0.01
IGL01982:Abca12 APN 1 71346698 missense probably benign 0.34
IGL02136:Abca12 APN 1 71247142 missense probably damaging 1.00
IGL02172:Abca12 APN 1 71302658 missense probably benign 0.09
IGL02222:Abca12 APN 1 71282886 missense probably benign 0.40
IGL02266:Abca12 APN 1 71268201 nonsense probably null
IGL02449:Abca12 APN 1 71401749 splice site probably null
IGL02471:Abca12 APN 1 71258198 missense probably benign 0.00
IGL02496:Abca12 APN 1 71288553 missense possibly damaging 0.55
IGL02552:Abca12 APN 1 71294747 missense probably damaging 0.96
IGL02795:Abca12 APN 1 71288748 missense probably damaging 1.00
IGL03000:Abca12 APN 1 71321800 missense probably benign 0.01
IGL03031:Abca12 APN 1 71314024 missense probably benign 0.00
IGL03131:Abca12 APN 1 71346702 missense probably benign
IGL03260:Abca12 APN 1 71284099 missense probably damaging 1.00
IGL03324:Abca12 APN 1 71314008 missense probably benign
IGL03408:Abca12 APN 1 71264795 missense probably damaging 1.00
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0121:Abca12 UTSW 1 71259786 splice site probably null
R0172:Abca12 UTSW 1 71279402 missense probably damaging 0.99
R0196:Abca12 UTSW 1 71259813 missense possibly damaging 0.81
R0400:Abca12 UTSW 1 71259776 splice site probably benign
R0466:Abca12 UTSW 1 71302663 missense probably damaging 1.00
R0616:Abca12 UTSW 1 71302671 missense probably damaging 1.00
R0668:Abca12 UTSW 1 71263614 missense probably damaging 1.00
R0928:Abca12 UTSW 1 71349174 missense probably benign 0.06
R1036:Abca12 UTSW 1 71263410 critical splice donor site probably null
R1086:Abca12 UTSW 1 71295061 splice site probably benign
R1300:Abca12 UTSW 1 71244808 missense probably damaging 1.00
R1337:Abca12 UTSW 1 71294819 missense probably benign 0.03
R1356:Abca12 UTSW 1 71302953 splice site probably benign
R1372:Abca12 UTSW 1 71294857 missense probably damaging 1.00
R1434:Abca12 UTSW 1 71309800 missense probably benign 0.00
R1580:Abca12 UTSW 1 71265965 missense possibly damaging 0.65
R1675:Abca12 UTSW 1 71263411 critical splice donor site probably null
R1773:Abca12 UTSW 1 71288596 missense probably damaging 1.00
R1829:Abca12 UTSW 1 71295029 missense probably benign 0.26
R1922:Abca12 UTSW 1 71319924 missense probably benign 0.10
R1927:Abca12 UTSW 1 71244840 missense probably damaging 1.00
R2115:Abca12 UTSW 1 71244771 missense probably benign 0.01
R2146:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2148:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2150:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2299:Abca12 UTSW 1 71258222 missense probably damaging 1.00
R2392:Abca12 UTSW 1 71258105 missense probably damaging 1.00
R2571:Abca12 UTSW 1 71249885 missense probably benign 0.00
R3077:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3078:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3705:Abca12 UTSW 1 71285705 missense probably damaging 1.00
R3800:Abca12 UTSW 1 71265887 missense probably damaging 1.00
R3905:Abca12 UTSW 1 71268230 missense possibly damaging 0.79
R3905:Abca12 UTSW 1 71279457 missense probably benign 0.02
R3962:Abca12 UTSW 1 71274515 splice site probably null
R4082:Abca12 UTSW 1 71267463 missense possibly damaging 0.64
R4131:Abca12 UTSW 1 71319871 critical splice donor site probably null
R4214:Abca12 UTSW 1 71288697 missense probably damaging 0.99
R4403:Abca12 UTSW 1 71267436 missense probably damaging 1.00
R4524:Abca12 UTSW 1 71302917 missense probably benign 0.19
R4615:Abca12 UTSW 1 71330334 missense probably benign
R4617:Abca12 UTSW 1 71330334 missense probably benign
R4714:Abca12 UTSW 1 71321450 missense probably benign 0.00
R4809:Abca12 UTSW 1 71278856 missense probably benign 0.10
R4810:Abca12 UTSW 1 71303612 missense probably benign 0.00
R4825:Abca12 UTSW 1 71302685 missense possibly damaging 0.70
R4990:Abca12 UTSW 1 71294939 missense possibly damaging 0.61
R5013:Abca12 UTSW 1 71264767 missense probably damaging 0.99
R5026:Abca12 UTSW 1 71317224 missense probably benign 0.04
R5064:Abca12 UTSW 1 71300960 missense probably damaging 1.00
R5188:Abca12 UTSW 1 71291492 missense probably benign 0.23
R5234:Abca12 UTSW 1 71263664 missense probably damaging 0.99
R5267:Abca12 UTSW 1 71335774 splice site probably benign
R5302:Abca12 UTSW 1 71283952 missense possibly damaging 0.91
R5441:Abca12 UTSW 1 71295056 missense probably damaging 1.00
R5451:Abca12 UTSW 1 71294917 missense possibly damaging 0.94
R5526:Abca12 UTSW 1 71292446 missense probably benign 0.29
R5529:Abca12 UTSW 1 71264881 missense probably damaging 1.00
R5615:Abca12 UTSW 1 71307059 missense probably damaging 1.00
R5649:Abca12 UTSW 1 71291342 missense probably damaging 1.00
R5800:Abca12 UTSW 1 71321432 missense possibly damaging 0.78
R5807:Abca12 UTSW 1 71303492 missense probably damaging 1.00
R5878:Abca12 UTSW 1 71346633 missense possibly damaging 0.79
R5987:Abca12 UTSW 1 71258098 missense probably damaging 1.00
R6280:Abca12 UTSW 1 71272460 missense probably benign 0.04
R6316:Abca12 UTSW 1 71313959 missense probably benign 0.01
R6337:Abca12 UTSW 1 71295013 missense probably damaging 1.00
R6383:Abca12 UTSW 1 71247184 missense probably benign 0.03
R6564:Abca12 UTSW 1 71309850 missense possibly damaging 0.57
R6582:Abca12 UTSW 1 71258225 missense probably benign 0.00
R6756:Abca12 UTSW 1 71259353 splice site probably null
R6876:Abca12 UTSW 1 71263508 missense probably damaging 0.98
R6999:Abca12 UTSW 1 71317162 nonsense probably null
R7145:Abca12 UTSW 1 71307053 missense possibly damaging 0.92
R7272:Abca12 UTSW 1 71248432 missense probably damaging 0.99
R7285:Abca12 UTSW 1 71349155 nonsense probably null
R7421:Abca12 UTSW 1 71247136 nonsense probably null
X0013:Abca12 UTSW 1 71248433 missense probably damaging 0.99
X0018:Abca12 UTSW 1 71314510 missense probably benign
X0063:Abca12 UTSW 1 71349064 missense probably benign 0.15
X0065:Abca12 UTSW 1 71341461 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTAGCATGTTTTAAGAGGCTC -3'
(R):5'- GGAATCCTAAAACTGCATTTGGTTC -3'

Sequencing Primer
(F):5'- CTAGCATGTTTTAAGAGGCTCTAAGG -3'
(R):5'- CTCTTGTTTCAGACGCTAGAAC -3'
Posted On2014-10-01