Incidental Mutation 'R2149:BC003331'
ID234069
Institutional Source Beutler Lab
Gene Symbol BC003331
Ensembl Gene ENSMUSG00000006010
Gene NamecDNA sequence BC003331
Synonyms
MMRRC Submission 040152-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.519) question?
Stock #R2149 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location150361305-150393080 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 150388559 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 66 (N66K)
Ref Sequence ENSEMBL: ENSMUSP00000092050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006167] [ENSMUST00000094477] [ENSMUST00000097546] [ENSMUST00000097547] [ENSMUST00000111913] [ENSMUST00000119161] [ENSMUST00000124973]
Predicted Effect probably benign
Transcript: ENSMUST00000006167
AA Change: N66K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000006167
Gene: ENSMUSG00000006010
AA Change: N66K

DomainStartEndE-ValueType
Pfam:ODR4-like 28 364 1.8e-107 PFAM
transmembrane domain 402 424 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094477
AA Change: N66K

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000092050
Gene: ENSMUSG00000006010
AA Change: N66K

DomainStartEndE-ValueType
Pfam:ODR4-like 28 383 2.8e-120 PFAM
transmembrane domain 424 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097546
AA Change: N66K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000095152
Gene: ENSMUSG00000006010
AA Change: N66K

DomainStartEndE-ValueType
Pfam:ODR4-like 28 364 1.8e-107 PFAM
transmembrane domain 402 424 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097547
AA Change: N66K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000095153
Gene: ENSMUSG00000006010
AA Change: N66K

DomainStartEndE-ValueType
Pfam:ODR4-like 28 209 1.2e-57 PFAM
Pfam:ODR4-like 206 354 3.1e-43 PFAM
transmembrane domain 392 414 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111913
AA Change: N66K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000107544
Gene: ENSMUSG00000006010
AA Change: N66K

DomainStartEndE-ValueType
Pfam:ODR4-like 28 386 7.1e-113 PFAM
transmembrane domain 424 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119161
SMART Domains Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
coiled coil region 49 370 N/A INTRINSIC
coiled coil region 423 515 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
coiled coil region 539 604 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 782 795 N/A INTRINSIC
low complexity region 811 826 N/A INTRINSIC
low complexity region 1003 1019 N/A INTRINSIC
Pfam:TPR_MLP1_2 1036 1167 9.1e-33 PFAM
coiled coil region 1215 1421 N/A INTRINSIC
coiled coil region 1473 1629 N/A INTRINSIC
internal_repeat_3 1630 1691 1.48e-5 PROSPERO
low complexity region 1695 1717 N/A INTRINSIC
low complexity region 1761 1777 N/A INTRINSIC
internal_repeat_5 1814 1827 5.58e-5 PROSPERO
internal_repeat_3 1819 1881 1.48e-5 PROSPERO
internal_repeat_4 1875 1895 5.58e-5 PROSPERO
internal_repeat_1 1893 1919 2.03e-6 PROSPERO
low complexity region 1920 1933 N/A INTRINSIC
low complexity region 1942 1981 N/A INTRINSIC
low complexity region 1989 2014 N/A INTRINSIC
internal_repeat_4 2017 2036 5.58e-5 PROSPERO
low complexity region 2059 2078 N/A INTRINSIC
internal_repeat_2 2084 2135 3.95e-6 PROSPERO
internal_repeat_5 2127 2140 5.58e-5 PROSPERO
internal_repeat_1 2154 2179 2.03e-6 PROSPERO
internal_repeat_2 2156 2212 3.95e-6 PROSPERO
low complexity region 2239 2251 N/A INTRINSIC
low complexity region 2263 2277 N/A INTRINSIC
low complexity region 2292 2314 N/A INTRINSIC
low complexity region 2346 2357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124973
SMART Domains Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 24 77 N/A INTRINSIC
coiled coil region 123 444 N/A INTRINSIC
coiled coil region 497 589 N/A INTRINSIC
low complexity region 592 608 N/A INTRINSIC
coiled coil region 613 678 N/A INTRINSIC
low complexity region 764 777 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
Pfam:TPR_MLP1_2 1112 1240 5.1e-37 PFAM
coiled coil region 1289 1495 N/A INTRINSIC
low complexity region 1682 1698 N/A INTRINSIC
internal_repeat_5 1703 1750 8.04e-5 PROSPERO
internal_repeat_3 1704 1765 1.07e-5 PROSPERO
low complexity region 1769 1791 N/A INTRINSIC
low complexity region 1835 1851 N/A INTRINSIC
internal_repeat_5 1857 1900 8.04e-5 PROSPERO
internal_repeat_6 1887 1911 8.04e-5 PROSPERO
internal_repeat_3 1893 1955 1.07e-5 PROSPERO
internal_repeat_4 1949 1969 4.1e-5 PROSPERO
internal_repeat_1 1967 1993 1.42e-6 PROSPERO
low complexity region 1994 2007 N/A INTRINSIC
low complexity region 2016 2055 N/A INTRINSIC
low complexity region 2063 2088 N/A INTRINSIC
internal_repeat_4 2091 2110 4.1e-5 PROSPERO
internal_repeat_6 2108 2132 8.04e-5 PROSPERO
low complexity region 2133 2152 N/A INTRINSIC
internal_repeat_2 2158 2209 2.78e-6 PROSPERO
internal_repeat_1 2228 2253 1.42e-6 PROSPERO
internal_repeat_2 2230 2286 2.78e-6 PROSPERO
low complexity region 2313 2325 N/A INTRINSIC
low complexity region 2337 2351 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2420 2431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150615
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik A G 1: 43,742,336 D126G probably damaging Het
1700006A11Rik T C 3: 124,409,686 E414G probably benign Het
3632451O06Rik T C 14: 49,751,571 D647G probably benign Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Abca13 A G 11: 9,267,508 T317A possibly damaging Het
Acap3 T G 4: 155,905,625 L750R probably damaging Het
Anapc7 T A 5: 122,443,826 S511T probably benign Het
Anp32a T A 9: 62,371,802 F46Y probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arid2 T C 15: 96,370,835 I943T probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Btnl6 T C 17: 34,514,347 N218S possibly damaging Het
Capn11 T C 17: 45,633,107 probably null Het
Clcnkb C T 4: 141,408,017 G470D probably damaging Het
Clic6 T A 16: 92,499,207 S252T probably benign Het
Col28a1 T C 6: 8,155,383 K318E possibly damaging Het
Col5a3 A T 9: 20,771,270 V1626D unknown Het
Col6a4 C A 9: 106,076,929 A404S probably benign Het
Cyp2j5 G T 4: 96,641,340 H265N possibly damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dock2 A G 11: 34,229,472 probably null Het
Emilin2 T C 17: 71,273,992 S580G probably benign Het
Fbn2 C A 18: 58,102,325 probably null Het
Gfm1 T C 3: 67,474,560 L693P probably damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gpha2 A G 19: 6,226,982 T38A probably damaging Het
Gtf2h3 T C 5: 124,599,785 probably benign Het
Hmgxb3 T C 18: 61,157,674 T376A probably benign Het
Hspa12b A G 2: 131,143,057 D416G probably damaging Het
Immt C T 6: 71,844,675 R28* probably null Het
Iqgap1 T C 7: 80,762,560 Y180C probably damaging Het
Kcnq3 T A 15: 66,023,729 D322V probably damaging Het
Kifc2 C A 15: 76,662,221 L268I probably benign Het
Lama1 T C 17: 67,773,865 M1296T possibly damaging Het
Lipk A G 19: 34,021,617 N104S possibly damaging Het
Lrrc14b T A 13: 74,363,757 N68I possibly damaging Het
Lrrc28 A T 7: 67,531,682 D268E probably damaging Het
Ly6c2 T C 15: 75,108,543 *132W probably null Het
Msh6 A G 17: 87,986,088 E757G probably damaging Het
Mtss1l T C 8: 110,726,383 V47A possibly damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Nalcn A T 14: 123,370,017 I680N probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1501 A C 19: 13,838,582 V197G probably damaging Het
Olfr61 C T 7: 140,638,052 T117M probably damaging Het
Olfr713 A T 7: 107,036,338 Y61F possibly damaging Het
Olfr912 T C 9: 38,581,508 V77A probably benign Het
Oosp2 A T 19: 11,649,614 L17* probably null Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pde4dip T A 3: 97,792,836 Q300L possibly damaging Het
Phf2 T C 13: 48,804,689 K950E unknown Het
Pira2 G A 7: 3,844,171 P124L probably damaging Het
Plpp4 C T 7: 129,379,371 T157I probably benign Het
Polrmt G A 10: 79,740,275 Q545* probably null Het
Ptprs A G 17: 56,417,706 F1511L probably damaging Het
Sbno1 T C 5: 124,402,119 probably null Het
Setd1a T A 7: 127,786,518 V256D possibly damaging Het
Slamf1 T C 1: 171,767,272 S16P probably damaging Het
Slc16a14 T C 1: 84,907,399 D473G probably damaging Het
Slc8a2 A T 7: 16,159,164 H917L probably damaging Het
Sorbs2 A C 8: 45,795,443 D442A probably damaging Het
Srp68 G T 11: 116,260,867 T301K possibly damaging Het
Stab2 A T 10: 86,865,040 C457* probably null Het
Stk31 T G 6: 49,439,218 S652R possibly damaging Het
Stra6 T G 9: 58,152,539 S594R probably benign Het
Tbc1d9 G A 8: 83,271,449 E1212K probably damaging Het
Thada C T 17: 84,441,764 R593Q probably damaging Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tmem132c T A 5: 127,462,962 W351R probably damaging Het
Tmem206 T G 1: 191,345,109 F210V probably benign Het
Trim10 C T 17: 36,877,014 A374V probably benign Het
Try10 T C 6: 41,356,561 V80A probably benign Het
Ttn T C 2: 76,729,363 T29565A possibly damaging Het
Uggt2 G T 14: 119,075,345 Q351K probably benign Het
Vmn1r120 A T 7: 21,052,964 V274D probably damaging Het
Vmn1r62 A T 7: 5,675,359 H13L probably benign Het
Vmn2r101 C T 17: 19,588,963 T118I probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Wnt5a A G 14: 28,513,317 Y86C probably damaging Het
Xpa T C 4: 46,183,189 E200G probably damaging Het
Zc3h12a C T 4: 125,126,642 R136K possibly damaging Het
Zc3hav1 T C 6: 38,336,537 H191R probably damaging Het
Zfp804a A G 2: 82,258,664 T946A probably benign Het
Other mutations in BC003331
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01876:BC003331 APN 1 150382338 missense probably benign 0.10
IGL02189:BC003331 APN 1 150372033 missense possibly damaging 0.94
IGL02257:BC003331 APN 1 150386404 missense probably damaging 0.99
IGL02485:BC003331 APN 1 150363489 critical splice donor site probably null
IGL02585:BC003331 APN 1 150363521 missense probably damaging 0.96
IGL02712:BC003331 APN 1 150386356 critical splice donor site probably null
IGL02902:BC003331 APN 1 150384428 critical splice donor site probably null
IGL03014:BC003331 APN 1 150383053 splice site probably benign
IGL03124:BC003331 APN 1 150386425 missense probably benign 0.00
IGL03181:BC003331 APN 1 150363539 missense probably benign 0.06
IGL03344:BC003331 APN 1 150363544 missense probably damaging 0.99
R1170:BC003331 UTSW 1 150386391 missense probably benign 0.00
R1796:BC003331 UTSW 1 150375554 missense probably benign
R1902:BC003331 UTSW 1 150388609 unclassified probably null
R2155:BC003331 UTSW 1 150382335 missense possibly damaging 0.68
R2375:BC003331 UTSW 1 150390234 critical splice donor site probably null
R3786:BC003331 UTSW 1 150384531 missense probably benign 0.21
R3948:BC003331 UTSW 1 150388557 nonsense probably null
R4589:BC003331 UTSW 1 150384487 missense probably benign 0.11
R4590:BC003331 UTSW 1 150386352 splice site probably null
R4815:BC003331 UTSW 1 150374846 missense probably damaging 0.99
R5196:BC003331 UTSW 1 150382389 missense probably damaging 1.00
R5437:BC003331 UTSW 1 150363518 missense probably benign 0.01
R5549:BC003331 UTSW 1 150372158 missense possibly damaging 0.86
R5677:BC003331 UTSW 1 150374837 missense probably damaging 1.00
R5896:BC003331 UTSW 1 150380360 missense probably benign 0.10
R6472:BC003331 UTSW 1 150381522 missense probably benign 0.15
R7108:BC003331 UTSW 1 150382290 missense probably benign 0.01
R7402:BC003331 UTSW 1 150386356 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCATTCAATATTCAGAGCCTTCTC -3'
(R):5'- GGCTGTTCACTAAAATCAGTCC -3'

Sequencing Primer
(F):5'- AGCCTTCTCTAAAACTGTTTAAGTAC -3'
(R):5'- CAGTCCCCAAGAATATAGTTTTCATC -3'
Posted On2014-10-01