Incidental Mutation 'R2149:Muc2'
ID234111
Institutional Source Beutler Lab
Gene Symbol Muc2
Ensembl Gene ENSMUSG00000025515
Gene Namemucin 2
Synonyms2010015E03Rik
MMRRC Submission 040152-MU
Accession Numbers

Genbank: BC034197; MGI: 1339364

Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R2149 (G1)
Quality Score171
Status Not validated
Chromosome7
Chromosomal Location141690340-141754693 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CGTG to CGTGTG at 141699185 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000179227] [ENSMUST00000185406] [ENSMUST00000185823]
Predicted Effect probably null
Transcript: ENSMUST00000167366
SMART Domains Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
Pfam:VWD 3 72 2.3e-14 PFAM
C8 107 181 1.82e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179227
SMART Domains Protein: ENSMUSP00000136692
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
C8 11 85 1.61e-32 SMART
Blast:VWD 102 128 5e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000185406
SMART Domains Protein: ENSMUSP00000141040
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
VWD 20 183 1.5e-40 SMART
C8 216 290 3.9e-15 SMART
Pfam:TIL 293 349 5.4e-10 PFAM
VWC 351 411 7e-4 SMART
VWD 378 542 8.8e-44 SMART
C8 579 653 1.2e-36 SMART
SCOP:d1coua_ 654 728 4e-8 SMART
VWC_def 820 865 1.3e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185823
SMART Domains Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
Pfam:VWD 3 73 5.6e-14 PFAM
C8 108 182 1.4e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187789
Predicted Effect probably benign
Transcript: ENSMUST00000191587
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik A G 1: 43,742,336 D126G probably damaging Het
1700006A11Rik T C 3: 124,409,686 E414G probably benign Het
3632451O06Rik T C 14: 49,751,571 D647G probably benign Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Abca13 A G 11: 9,267,508 T317A possibly damaging Het
Acap3 T G 4: 155,905,625 L750R probably damaging Het
Anapc7 T A 5: 122,443,826 S511T probably benign Het
Anp32a T A 9: 62,371,802 F46Y probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arid2 T C 15: 96,370,835 I943T probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC003331 A T 1: 150,388,559 N66K probably benign Het
Btnl6 T C 17: 34,514,347 N218S possibly damaging Het
Capn11 T C 17: 45,633,107 probably null Het
Clcnkb C T 4: 141,408,017 G470D probably damaging Het
Clic6 T A 16: 92,499,207 S252T probably benign Het
Col28a1 T C 6: 8,155,383 K318E possibly damaging Het
Col5a3 A T 9: 20,771,270 V1626D unknown Het
Col6a4 C A 9: 106,076,929 A404S probably benign Het
Cyp2j5 G T 4: 96,641,340 H265N possibly damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dock2 A G 11: 34,229,472 probably null Het
Emilin2 T C 17: 71,273,992 S580G probably benign Het
Fbn2 C A 18: 58,102,325 probably null Het
Gfm1 T C 3: 67,474,560 L693P probably damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gpha2 A G 19: 6,226,982 T38A probably damaging Het
Gtf2h3 T C 5: 124,599,785 probably benign Het
Hmgxb3 T C 18: 61,157,674 T376A probably benign Het
Hspa12b A G 2: 131,143,057 D416G probably damaging Het
Immt C T 6: 71,844,675 R28* probably null Het
Iqgap1 T C 7: 80,762,560 Y180C probably damaging Het
Kcnq3 T A 15: 66,023,729 D322V probably damaging Het
Kifc2 C A 15: 76,662,221 L268I probably benign Het
Lama1 T C 17: 67,773,865 M1296T possibly damaging Het
Lipk A G 19: 34,021,617 N104S possibly damaging Het
Lrrc14b T A 13: 74,363,757 N68I possibly damaging Het
Lrrc28 A T 7: 67,531,682 D268E probably damaging Het
Ly6c2 T C 15: 75,108,543 *132W probably null Het
Msh6 A G 17: 87,986,088 E757G probably damaging Het
Mtss1l T C 8: 110,726,383 V47A possibly damaging Het
Nalcn A T 14: 123,370,017 I680N probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1501 A C 19: 13,838,582 V197G probably damaging Het
Olfr61 C T 7: 140,638,052 T117M probably damaging Het
Olfr713 A T 7: 107,036,338 Y61F possibly damaging Het
Olfr912 T C 9: 38,581,508 V77A probably benign Het
Oosp2 A T 19: 11,649,614 L17* probably null Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pde4dip T A 3: 97,792,836 Q300L possibly damaging Het
Phf2 T C 13: 48,804,689 K950E unknown Het
Pira2 G A 7: 3,844,171 P124L probably damaging Het
Plpp4 C T 7: 129,379,371 T157I probably benign Het
Polrmt G A 10: 79,740,275 Q545* probably null Het
Ptprs A G 17: 56,417,706 F1511L probably damaging Het
Sbno1 T C 5: 124,402,119 probably null Het
Setd1a T A 7: 127,786,518 V256D possibly damaging Het
Slamf1 T C 1: 171,767,272 S16P probably damaging Het
Slc16a14 T C 1: 84,907,399 D473G probably damaging Het
Slc8a2 A T 7: 16,159,164 H917L probably damaging Het
Sorbs2 A C 8: 45,795,443 D442A probably damaging Het
Srp68 G T 11: 116,260,867 T301K possibly damaging Het
Stab2 A T 10: 86,865,040 C457* probably null Het
Stk31 T G 6: 49,439,218 S652R possibly damaging Het
Stra6 T G 9: 58,152,539 S594R probably benign Het
Tbc1d9 G A 8: 83,271,449 E1212K probably damaging Het
Thada C T 17: 84,441,764 R593Q probably damaging Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tmem132c T A 5: 127,462,962 W351R probably damaging Het
Tmem206 T G 1: 191,345,109 F210V probably benign Het
Trim10 C T 17: 36,877,014 A374V probably benign Het
Try10 T C 6: 41,356,561 V80A probably benign Het
Ttn T C 2: 76,729,363 T29565A possibly damaging Het
Uggt2 G T 14: 119,075,345 Q351K probably benign Het
Vmn1r120 A T 7: 21,052,964 V274D probably damaging Het
Vmn1r62 A T 7: 5,675,359 H13L probably benign Het
Vmn2r101 C T 17: 19,588,963 T118I probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Wnt5a A G 14: 28,513,317 Y86C probably damaging Het
Xpa T C 4: 46,183,189 E200G probably damaging Het
Zc3h12a C T 4: 125,126,642 R136K possibly damaging Het
Zc3hav1 T C 6: 38,336,537 H191R probably damaging Het
Zfp804a A G 2: 82,258,664 T946A probably benign Het
Other mutations in Muc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Eeyore APN 7 141693356 missense probably benign 0.35
kenny APN 7 nonsense
Winnie APN 7 141699460 missense probably damaging 1.00
IGL01303:Muc2 APN 7 141752395 missense probably benign
IGL01482:Muc2 APN 7 141754060 missense probably damaging 0.96
IGL01875:Muc2 APN 7 141752740 missense probably damaging 0.99
IGL02088:Muc2 APN 7 141751504 missense probably damaging 1.00
IGL02415:Muc2 APN 7 141751872 nonsense probably null
IGL02548:Muc2 APN 7 141751857 missense probably damaging 1.00
IGL02836:Muc2 APN 7 141746713 unclassified probably benign
IGL03196:Muc2 APN 7 141747630 missense probably damaging 0.97
Muskatenwein UTSW 7 141753439 missense unknown
nomoco UTSW 7 141753719 missense probably damaging 1.00
Schlendrian UTSW 7 141695682 missense probably damaging 1.00
Seco UTSW 7 141698733 missense probably damaging 1.00
E0370:Muc2 UTSW 7 141696355 missense probably damaging 1.00
R0127:Muc2 UTSW 7 141748954 missense probably benign 0.00
R0179:Muc2 UTSW 7 141748971 missense probably damaging 1.00
R0201:Muc2 UTSW 7 141699185 frame shift probably null
R0299:Muc2 UTSW 7 141752729 missense probably damaging 1.00
R0547:Muc2 UTSW 7 141699185 frame shift probably null
R0699:Muc2 UTSW 7 141752300 missense probably damaging 1.00
R0900:Muc2 UTSW 7 141699185 frame shift probably null
R1348:Muc2 UTSW 7 141699185 frame shift probably null
R1466:Muc2 UTSW 7 141748974 missense probably damaging 1.00
R1466:Muc2 UTSW 7 141748974 missense probably damaging 1.00
R1625:Muc2 UTSW 7 141697162 missense probably damaging 1.00
R2010:Muc2 UTSW 7 141700875 missense probably damaging 0.99
R2163:Muc2 UTSW 7 141699185 frame shift probably null
R3008:Muc2 UTSW 7 141695104 missense possibly damaging 0.93
R3110:Muc2 UTSW 7 141745488 unclassified probably benign
R3112:Muc2 UTSW 7 141745488 unclassified probably benign
R3424:Muc2 UTSW 7 141693352 missense probably damaging 0.99
R3786:Muc2 UTSW 7 141697347 missense probably benign 0.01
R3854:Muc2 UTSW 7 141754344 missense probably damaging 1.00
R3964:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3965:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3966:Muc2 UTSW 7 141699664 missense probably benign 0.17
R3973:Muc2 UTSW 7 141746804 unclassified probably benign
R3974:Muc2 UTSW 7 141746804 unclassified probably benign
R3976:Muc2 UTSW 7 141746804 unclassified probably benign
R4327:Muc2 UTSW 7 141695334 missense probably damaging 0.96
R4694:Muc2 UTSW 7 141752345 missense probably damaging 1.00
R4764:Muc2 UTSW 7 141745608 missense possibly damaging 0.88
R4769:Muc2 UTSW 7 141699691 critical splice donor site probably null
R4798:Muc2 UTSW 7 141754140 missense probably benign 0.01
R4900:Muc2 UTSW 7 141749543 missense probably benign 0.32
R5383:Muc2 UTSW 7 141753719 missense probably damaging 1.00
R5489:Muc2 UTSW 7 141751432 missense probably benign 0.00
R5615:Muc2 UTSW 7 141691203 missense probably damaging 1.00
R5856:Muc2 UTSW 7 141745644 unclassified probably benign
R5919:Muc2 UTSW 7 141694928 missense probably damaging 0.97
R5953:Muc2 UTSW 7 141701382 missense probably damaging 0.96
R5979:Muc2 UTSW 7 141697250 unclassified probably null
R5979:Muc2 UTSW 7 141751406 missense probably damaging 0.99
R6175:Muc2 UTSW 7 141696632 missense probably damaging 1.00
R6213:Muc2 UTSW 7 141751414 missense probably damaging 1.00
R6281:Muc2 UTSW 7 141752403 missense probably damaging 1.00
R6321:Muc2 UTSW 7 141700828 missense probably benign 0.28
R6390:Muc2 UTSW 7 141752146 missense probably damaging 0.97
R6485:Muc2 UTSW 7 141746736 unclassified probably benign
R6582:Muc2 UTSW 7 141696698 missense probably benign 0.00
R6683:Muc2 UTSW 7 141751477 missense probably benign 0.38
R6896:Muc2 UTSW 7 141752695 missense possibly damaging 0.48
R6906:Muc2 UTSW 7 141698733 missense probably damaging 1.00
R6924:Muc2 UTSW 7 141697834 missense possibly damaging 0.87
R7040:Muc2 UTSW 7 141751457 missense unknown
R7222:Muc2 UTSW 7 141704209 missense
R7251:Muc2 UTSW 7 141692722 missense possibly damaging 0.91
R7282:Muc2 UTSW 7 141752744 missense
R7315:Muc2 UTSW 7 141690402 missense probably damaging 0.99
R7421:Muc2 UTSW 7 141748126 missense
R7556:Muc2 UTSW 7 141753702 missense not run
Predicted Primers PCR Primer
(F):5'- CCCCATGTGTATGTGCATGTG -3'
(R):5'- AGCTTGGGAAGATCCTGAGG -3'

Sequencing Primer
(F):5'- gcatgtgtgtgtgtgtgt -3'
(R):5'- ATCCACGGGACCTGTGTAG -3'
Posted On2014-10-01