Incidental Mutation 'R2149:Col5a3'
ID234115
Institutional Source Beutler Lab
Gene Symbol Col5a3
Ensembl Gene ENSMUSG00000004098
Gene Namecollagen, type V, alpha 3
SynonymsPro-alpha3(V)
MMRRC Submission 040152-MU
Accession Numbers

Ncbi RefSeq: NM_016919.2; MGI:1858212

Is this an essential gene? Possibly non essential (E-score: 0.474) question?
Stock #R2149 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location20770050-20815067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20771270 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1626 (V1626D)
Ref Sequence ENSEMBL: ENSMUSP00000004201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004201]
Predicted Effect unknown
Transcript: ENSMUST00000004201
AA Change: V1626D
SMART Domains Protein: ENSMUSP00000004201
Gene: ENSMUSG00000004098
AA Change: V1626D

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TSPN 32 211 7.08e-28 SMART
LamG 89 210 2.13e-2 SMART
low complexity region 247 267 N/A INTRINSIC
low complexity region 295 314 N/A INTRINSIC
low complexity region 341 347 N/A INTRINSIC
low complexity region 369 381 N/A INTRINSIC
low complexity region 391 434 N/A INTRINSIC
low complexity region 461 474 N/A INTRINSIC
Pfam:Collagen 475 538 5.5e-10 PFAM
low complexity region 597 616 N/A INTRINSIC
low complexity region 628 694 N/A INTRINSIC
internal_repeat_3 703 737 7.13e-16 PROSPERO
low complexity region 742 821 N/A INTRINSIC
low complexity region 823 844 N/A INTRINSIC
low complexity region 859 889 N/A INTRINSIC
internal_repeat_2 892 1081 5.05e-17 PROSPERO
internal_repeat_1 996 1133 7.47e-22 PROSPERO
internal_repeat_3 1105 1139 7.13e-16 PROSPERO
low complexity region 1140 1165 N/A INTRINSIC
low complexity region 1168 1255 N/A INTRINSIC
low complexity region 1258 1282 N/A INTRINSIC
low complexity region 1285 1306 N/A INTRINSIC
low complexity region 1311 1418 N/A INTRINSIC
Pfam:Collagen 1429 1491 9.5e-10 PFAM
COLFI 1508 1738 7.98e-92 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype Strain: 5000519
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. Mutations in this gene are thought to be responsible for the symptoms of a subset of patients with Ehlers-Danlos syndrome type III. Messages of several sizes can be detected in northern blots but sequence information cannot confirm the identity of the shorter messages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show decreased pancreatic beta cell mass, hyperglycemia, hypoinsulinemia, impaired glucose tolerance, insulin resistance and impaired glucose uptake. Homozygous females show decreased susceptibility to diet-induced obesity and a thin hypodermal fat layer. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik A G 1: 43,742,336 D126G probably damaging Het
1700006A11Rik T C 3: 124,409,686 E414G probably benign Het
3632451O06Rik T C 14: 49,751,571 D647G probably benign Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Abca13 A G 11: 9,267,508 T317A possibly damaging Het
Acap3 T G 4: 155,905,625 L750R probably damaging Het
Anapc7 T A 5: 122,443,826 S511T probably benign Het
Anp32a T A 9: 62,371,802 F46Y probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arid2 T C 15: 96,370,835 I943T probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC003331 A T 1: 150,388,559 N66K probably benign Het
Btnl6 T C 17: 34,514,347 N218S possibly damaging Het
Capn11 T C 17: 45,633,107 probably null Het
Clcnkb C T 4: 141,408,017 G470D probably damaging Het
Clic6 T A 16: 92,499,207 S252T probably benign Het
Col28a1 T C 6: 8,155,383 K318E possibly damaging Het
Col6a4 C A 9: 106,076,929 A404S probably benign Het
Cyp2j5 G T 4: 96,641,340 H265N possibly damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dock2 A G 11: 34,229,472 probably null Het
Emilin2 T C 17: 71,273,992 S580G probably benign Het
Fbn2 C A 18: 58,102,325 probably null Het
Gfm1 T C 3: 67,474,560 L693P probably damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gpha2 A G 19: 6,226,982 T38A probably damaging Het
Gtf2h3 T C 5: 124,599,785 probably benign Het
Hmgxb3 T C 18: 61,157,674 T376A probably benign Het
Hspa12b A G 2: 131,143,057 D416G probably damaging Het
Immt C T 6: 71,844,675 R28* probably null Het
Iqgap1 T C 7: 80,762,560 Y180C probably damaging Het
Kcnq3 T A 15: 66,023,729 D322V probably damaging Het
Kifc2 C A 15: 76,662,221 L268I probably benign Het
Lama1 T C 17: 67,773,865 M1296T possibly damaging Het
Lipk A G 19: 34,021,617 N104S possibly damaging Het
Lrrc14b T A 13: 74,363,757 N68I possibly damaging Het
Lrrc28 A T 7: 67,531,682 D268E probably damaging Het
Ly6c2 T C 15: 75,108,543 *132W probably null Het
Msh6 A G 17: 87,986,088 E757G probably damaging Het
Mtss1l T C 8: 110,726,383 V47A possibly damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Nalcn A T 14: 123,370,017 I680N probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1501 A C 19: 13,838,582 V197G probably damaging Het
Olfr61 C T 7: 140,638,052 T117M probably damaging Het
Olfr713 A T 7: 107,036,338 Y61F possibly damaging Het
Olfr912 T C 9: 38,581,508 V77A probably benign Het
Oosp2 A T 19: 11,649,614 L17* probably null Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pde4dip T A 3: 97,792,836 Q300L possibly damaging Het
Phf2 T C 13: 48,804,689 K950E unknown Het
Pira2 G A 7: 3,844,171 P124L probably damaging Het
Plpp4 C T 7: 129,379,371 T157I probably benign Het
Polrmt G A 10: 79,740,275 Q545* probably null Het
Ptprs A G 17: 56,417,706 F1511L probably damaging Het
Sbno1 T C 5: 124,402,119 probably null Het
Setd1a T A 7: 127,786,518 V256D possibly damaging Het
Slamf1 T C 1: 171,767,272 S16P probably damaging Het
Slc16a14 T C 1: 84,907,399 D473G probably damaging Het
Slc8a2 A T 7: 16,159,164 H917L probably damaging Het
Sorbs2 A C 8: 45,795,443 D442A probably damaging Het
Srp68 G T 11: 116,260,867 T301K possibly damaging Het
Stab2 A T 10: 86,865,040 C457* probably null Het
Stk31 T G 6: 49,439,218 S652R possibly damaging Het
Stra6 T G 9: 58,152,539 S594R probably benign Het
Tbc1d9 G A 8: 83,271,449 E1212K probably damaging Het
Thada C T 17: 84,441,764 R593Q probably damaging Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tmem132c T A 5: 127,462,962 W351R probably damaging Het
Tmem206 T G 1: 191,345,109 F210V probably benign Het
Trim10 C T 17: 36,877,014 A374V probably benign Het
Try10 T C 6: 41,356,561 V80A probably benign Het
Ttn T C 2: 76,729,363 T29565A possibly damaging Het
Uggt2 G T 14: 119,075,345 Q351K probably benign Het
Vmn1r120 A T 7: 21,052,964 V274D probably damaging Het
Vmn1r62 A T 7: 5,675,359 H13L probably benign Het
Vmn2r101 C T 17: 19,588,963 T118I probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Wnt5a A G 14: 28,513,317 Y86C probably damaging Het
Xpa T C 4: 46,183,189 E200G probably damaging Het
Zc3h12a C T 4: 125,126,642 R136K possibly damaging Het
Zc3hav1 T C 6: 38,336,537 H191R probably damaging Het
Zfp804a A G 2: 82,258,664 T946A probably benign Het
Other mutations in Col5a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Col5a3 APN 9 20786389 nonsense probably null
IGL01548:Col5a3 APN 9 20803000 splice site probably benign
IGL02164:Col5a3 APN 9 20792643 critical splice donor site probably null
IGL02297:Col5a3 APN 9 20772154 missense unknown
IGL02333:Col5a3 APN 9 20799306 missense unknown
IGL02349:Col5a3 APN 9 20772361 missense unknown
IGL02390:Col5a3 APN 9 20776996 missense unknown
IGL02685:Col5a3 APN 9 20772205 missense unknown
IGL02941:Col5a3 APN 9 20804666 missense unknown
IGL03001:Col5a3 APN 9 20807744 missense unknown
IGL03061:Col5a3 APN 9 20797572 critical splice donor site probably null
IGL03102:Col5a3 APN 9 20804635 critical splice donor site probably null
IGL03308:Col5a3 APN 9 20808379 missense unknown
IGL03372:Col5a3 APN 9 20775328 missense unknown
R0002:Col5a3 UTSW 9 20809856 critical splice acceptor site probably null
R0012:Col5a3 UTSW 9 20777108 splice site probably benign
R0316:Col5a3 UTSW 9 20775325 missense unknown
R0357:Col5a3 UTSW 9 20807768 splice site probably benign
R0360:Col5a3 UTSW 9 20772466 missense unknown
R0483:Col5a3 UTSW 9 20782481 splice site probably null
R0485:Col5a3 UTSW 9 20782708 missense probably damaging 0.99
R0627:Col5a3 UTSW 9 20775485 missense unknown
R1035:Col5a3 UTSW 9 20793499 splice site probably benign
R1051:Col5a3 UTSW 9 20775235 missense unknown
R1295:Col5a3 UTSW 9 20808418 missense unknown
R1438:Col5a3 UTSW 9 20779957 missense probably damaging 0.99
R1622:Col5a3 UTSW 9 20772220 missense unknown
R1668:Col5a3 UTSW 9 20771096 missense unknown
R1680:Col5a3 UTSW 9 20784668 critical splice donor site probably null
R2112:Col5a3 UTSW 9 20809777 missense unknown
R2159:Col5a3 UTSW 9 20771310 missense unknown
R2939:Col5a3 UTSW 9 20795658 missense unknown
R3236:Col5a3 UTSW 9 20807653 missense unknown
R3845:Col5a3 UTSW 9 20808377 missense unknown
R4598:Col5a3 UTSW 9 20774559 critical splice donor site probably null
R4599:Col5a3 UTSW 9 20774559 critical splice donor site probably null
R4611:Col5a3 UTSW 9 20814896 unclassified probably benign
R4713:Col5a3 UTSW 9 20793574 missense unknown
R4723:Col5a3 UTSW 9 20809591 missense unknown
R5209:Col5a3 UTSW 9 20778643 intron probably benign
R5336:Col5a3 UTSW 9 20799301 missense unknown
R5378:Col5a3 UTSW 9 20797576 missense unknown
R5614:Col5a3 UTSW 9 20783476 splice site probably benign
R5775:Col5a3 UTSW 9 20801072 missense unknown
R5895:Col5a3 UTSW 9 20772442 missense unknown
R6048:Col5a3 UTSW 9 20807619 missense unknown
R6265:Col5a3 UTSW 9 20793764 missense unknown
R6372:Col5a3 UTSW 9 20785586 missense probably damaging 0.99
R6520:Col5a3 UTSW 9 20774052 missense unknown
R6558:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6608:Col5a3 UTSW 9 20774019 missense unknown
R6679:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6680:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6696:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6698:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6700:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6708:Col5a3 UTSW 9 20775035 missense unknown
R6712:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6714:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6828:Col5a3 UTSW 9 20798452 missense unknown
R7343:Col5a3 UTSW 9 20793946 critical splice donor site probably null
R7431:Col5a3 UTSW 9 20770835 makesense probably null
Predicted Primers PCR Primer
(F):5'- TTACCCGACAGCCATCATGG -3'
(R):5'- TCTCTACAAAGTCCTGGGCTC -3'

Sequencing Primer
(F):5'- CGACAGCCATCATGGGAGAC -3'
(R):5'- AGTGTTCAAGGCAATCCTCAG -3'
Posted On2014-10-01