Incidental Mutation 'R0196:Ttc14'
ID23416
Institutional Source Beutler Lab
Gene Symbol Ttc14
Ensembl Gene ENSMUSG00000027677
Gene Nametetratricopeptide repeat domain 14
SynonymscI-44, 2700016E08Rik, 4930434D01Rik, 4931403I22Rik, 4933402I15Rik
MMRRC Submission 038455-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R0196 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location33799832-33814860 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 33809254 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029222] [ENSMUST00000099153] [ENSMUST00000108210] [ENSMUST00000117915] [ENSMUST00000196369] [ENSMUST00000196975] [ENSMUST00000198529] [ENSMUST00000199222] [ENSMUST00000200271]
Predicted Effect probably benign
Transcript: ENSMUST00000029222
SMART Domains Protein: ENSMUSP00000029222
Gene: ENSMUSG00000027676

DomainStartEndE-ValueType
coiled coil region 16 67 N/A INTRINSIC
coiled coil region 164 198 N/A INTRINSIC
coiled coil region 232 339 N/A INTRINSIC
low complexity region 381 393 N/A INTRINSIC
internal_repeat_1 569 603 1.19e-5 PROSPERO
internal_repeat_1 598 635 1.19e-5 PROSPERO
coiled coil region 664 704 N/A INTRINSIC
coiled coil region 726 766 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
low complexity region 915 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099153
SMART Domains Protein: ENSMUSP00000096757
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000108210
AA Change: W656R
SMART Domains Protein: ENSMUSP00000103845
Gene: ENSMUSG00000027677
AA Change: W656R

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
coiled coil region 415 476 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000117915
AA Change: W604R
SMART Domains Protein: ENSMUSP00000112450
Gene: ENSMUSG00000027677
AA Change: W604R

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 254 287 6.19e-1 SMART
TPR 288 321 2.11e-3 SMART
TPR 329 362 1.88e0 SMART
coiled coil region 363 424 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196369
SMART Domains Protein: ENSMUSP00000142863
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
S1 21 105 7.28e-2 SMART
TPR 204 237 6.19e-1 SMART
TPR 238 271 2.11e-3 SMART
TPR 279 312 1.88e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196975
SMART Domains Protein: ENSMUSP00000142684
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 4.6e-4 SMART
TPR 254 287 3e-3 SMART
TPR 288 321 1e-5 SMART
TPR 329 362 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198529
SMART Domains Protein: ENSMUSP00000143073
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
Pfam:TPR_11 304 371 2.1e-12 PFAM
Pfam:TPR_2 306 339 1.9e-4 PFAM
Pfam:TPR_1 308 339 1.3e-4 PFAM
Pfam:TPR_1 340 373 2.9e-5 PFAM
Pfam:TPR_2 340 373 6.8e-4 PFAM
low complexity region 395 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199222
SMART Domains Protein: ENSMUSP00000142935
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
low complexity region 38 56 N/A INTRINSIC
S1 123 207 7.28e-2 SMART
TPR 306 339 6.19e-1 SMART
TPR 340 373 2.11e-3 SMART
TPR 381 414 1.88e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200271
SMART Domains Protein: ENSMUSP00000143738
Gene: ENSMUSG00000027677

DomainStartEndE-ValueType
S1 120 204 7.28e-2 SMART
TPR 303 336 6.19e-1 SMART
TPR 337 370 2.11e-3 SMART
TPR 378 411 1.88e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200536
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 81.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,616,247 probably benign Het
Aass G A 6: 23,109,520 P317L probably damaging Het
Abca12 T A 1: 71,259,813 N2313I possibly damaging Het
Adamts12 T C 15: 11,071,508 I46T probably benign Het
Adipoq T G 16: 23,146,643 probably null Het
Amy1 A T 3: 113,569,421 D92E probably benign Het
Asb15 G A 6: 24,564,393 R282Q probably damaging Het
Bag6 G C 17: 35,144,263 G693A probably damaging Het
Birc6 T C 17: 74,580,287 I870T possibly damaging Het
Cand2 A G 6: 115,789,502 K356R probably damaging Het
Cbfa2t3 T C 8: 122,633,337 Q525R possibly damaging Het
Ccdc94 C A 17: 55,964,653 D191E probably damaging Het
Cd4 T C 6: 124,867,806 R339G probably damaging Het
Cdh8 A G 8: 99,190,434 S350P probably damaging Het
Cep295 A T 9: 15,338,213 S469T probably damaging Het
Ckap2l A T 2: 129,285,422 S279T probably benign Het
Clnk T A 5: 38,769,939 N66Y probably damaging Het
Col27a1 A T 4: 63,224,266 T64S probably benign Het
Crtc1 T C 8: 70,386,221 D599G probably damaging Het
Cyp2c23 A C 19: 44,012,356 I363S probably damaging Het
Dnah10 A T 5: 124,834,075 I4519F possibly damaging Het
Dner T A 1: 84,370,832 I716F probably damaging Het
Dsel T G 1: 111,861,603 T401P possibly damaging Het
Egfr A G 11: 16,911,746 D1175G probably benign Het
Ephb3 A T 16: 21,218,054 N343I probably damaging Het
Fbxw10 T A 11: 62,877,244 F974I probably benign Het
Gfi1b T C 2: 28,613,774 Y138C probably damaging Het
Gm11168 T A 9: 3,005,175 L6H probably benign Het
Grb10 A C 11: 11,945,583 V247G probably damaging Het
Gstp2 A T 19: 4,040,514 probably null Het
Hars2 C T 18: 36,789,204 Q291* probably null Het
Hyal4 G T 6: 24,756,221 W146L probably damaging Het
Il22ra1 C T 4: 135,734,245 T107I possibly damaging Het
Itga8 A G 2: 12,204,729 probably null Het
Klhl25 T C 7: 75,865,702 S119P probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lrrc8c T C 5: 105,606,770 V137A probably benign Het
Macrod2 A T 2: 142,176,625 E226V probably damaging Het
Mcemp1 A T 8: 3,668,201 Q165L probably benign Het
Mcpt9 T A 14: 56,027,996 K82M probably benign Het
Mpzl3 A G 9: 45,062,160 T66A probably damaging Het
Msh6 G A 17: 87,980,360 V143I possibly damaging Het
Mug1 G A 6: 121,838,725 probably null Het
Ncr1 G T 7: 4,340,973 C153F probably damaging Het
Nf1 T A 11: 79,468,769 M1411K possibly damaging Het
Nf1 T A 11: 79,578,272 V786D probably damaging Het
Nisch T C 14: 31,203,394 probably benign Het
Nwd2 T A 5: 63,806,351 Y1093N probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr392 A T 11: 73,814,905 M59K probably damaging Het
Oxa1l T C 14: 54,363,487 I139T probably damaging Het
P3h3 T A 6: 124,845,272 N583Y probably damaging Het
Pcdh18 A T 3: 49,756,698 probably null Het
Pcnp C T 16: 56,024,533 probably benign Het
Pdzd8 G T 19: 59,301,131 D612E probably benign Het
Pi4kb T C 3: 94,998,950 S8P probably damaging Het
Pikfyve T G 1: 65,256,072 V1454G possibly damaging Het
Podn T C 4: 108,021,498 N246D probably damaging Het
Prg4 T C 1: 150,454,492 probably benign Het
R3hdm2 T C 10: 127,484,521 Y523H probably damaging Het
Rpf1 T A 3: 146,508,149 E231V possibly damaging Het
Slc16a10 C T 10: 40,056,615 E317K probably benign Het
Slc34a1 A T 13: 55,412,265 I435F probably damaging Het
Snx19 A G 9: 30,433,387 D629G probably damaging Het
Tomm70a T C 16: 57,146,100 I472T probably benign Het
Trp53 A G 11: 69,588,680 Y202C probably damaging Het
Ugt1a1 C T 1: 88,212,555 A185V possibly damaging Het
Usp28 A G 9: 49,028,278 D655G probably damaging Het
Vmn1r215 C T 13: 23,076,084 T98I probably damaging Het
Vmn2r121 G T X: 124,132,182 T426N probably benign Het
Vmn2r99 A G 17: 19,394,573 N852D probably benign Het
Xrn2 T A 2: 147,047,660 D654E probably damaging Het
Zfp335 C G 2: 164,896,145 A849P possibly damaging Het
Zfp954 C T 7: 7,115,391 V385M probably damaging Het
Zmynd15 A G 11: 70,464,226 T350A probably damaging Het
Other mutations in Ttc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Ttc14 APN 3 33803099 missense probably benign 0.35
IGL01326:Ttc14 APN 3 33801358 missense probably benign 0.14
R0427:Ttc14 UTSW 3 33803484 missense probably damaging 1.00
R1713:Ttc14 UTSW 3 33802920 missense probably damaging 1.00
R2312:Ttc14 UTSW 3 33807835 splice site probably null
R2434:Ttc14 UTSW 3 33801078 missense probably benign 0.40
R4794:Ttc14 UTSW 3 33803149 missense probably benign 0.00
R4825:Ttc14 UTSW 3 33801369 missense possibly damaging 0.88
R4888:Ttc14 UTSW 3 33806875 nonsense probably null
R5143:Ttc14 UTSW 3 33808901 unclassified probably benign
R6051:Ttc14 UTSW 3 33808924 unclassified probably benign
R6270:Ttc14 UTSW 3 33800388 missense possibly damaging 0.68
R6415:Ttc14 UTSW 3 33803575 missense possibly damaging 0.81
R6439:Ttc14 UTSW 3 33808819 unclassified probably benign
R7021:Ttc14 UTSW 3 33803497 missense probably damaging 0.99
R7571:Ttc14 UTSW 3 33809251 missense unknown
Predicted Primers PCR Primer
(F):5'- GCAGGATAGGTTACAGTGTCCAAATGC -3'
(R):5'- GGGCTAAAGAATCCCCAAACTTCTGG -3'

Sequencing Primer
(F):5'- TCACATCTTCAGGTGAAGTACCAG -3'
(R):5'- GCTATTTAGCATCTCTTCTGGAGC -3'
Posted On2013-04-16