Incidental Mutation 'R2150:Arhgap32'
ID234197
Institutional Source Beutler Lab
Gene Symbol Arhgap32
Ensembl Gene ENSMUSG00000041444
Gene NameRho GTPase activating protein 32
Synonymsp200RhoGAP, Grit, GC-GAP, PX-RICS, 3426406O18Rik
MMRRC Submission 040153-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2150 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location32116136-32268446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32116140 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2 (E2G)
Ref Sequence ENSEMBL: ENSMUSP00000133898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174641]
Predicted Effect possibly damaging
Transcript: ENSMUST00000174641
AA Change: E2G

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: E2G

DomainStartEndE-ValueType
Pfam:PX 132 226 5.6e-7 PFAM
SH3 262 320 7.4e-11 SMART
RhoGAP 383 564 9.6e-60 SMART
Blast:RhoGAP 581 647 9e-31 BLAST
low complexity region 867 882 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1262 1275 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1425 1442 N/A INTRINSIC
low complexity region 1653 1666 N/A INTRINSIC
low complexity region 2040 2049 N/A INTRINSIC
Meta Mutation Damage Score 0.046 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik C T 8: 87,586,063 Q159* probably null Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Adam34 A G 8: 43,652,501 Y36H probably benign Het
Adprm A G 11: 67,038,229 V312A probably benign Het
Anapc2 T C 2: 25,272,670 L52P probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Apoc4 T A 7: 19,678,635 T62S probably damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccdc63 C G 5: 122,127,565 A71P possibly damaging Het
Cdca2 T C 14: 67,714,809 K38E probably damaging Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dab2 T C 15: 6,416,917 V5A probably benign Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Disp1 A G 1: 183,088,372 F828S probably damaging Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dock2 A G 11: 34,229,472 probably null Het
Dsel A T 1: 111,860,257 N849K probably benign Het
Fah A T 7: 84,594,834 I239N probably damaging Het
Flt4 T C 11: 49,645,997 Y1265H probably benign Het
Ghdc T C 11: 100,769,192 E243G probably benign Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gm6619 A G 6: 131,489,058 I40V probably benign Het
Gpld1 T C 13: 24,962,647 V225A probably benign Het
Hectd4 T C 5: 121,253,858 probably benign Het
Igdcc4 A G 9: 65,125,335 I542V possibly damaging Het
Igsf9b T C 9: 27,334,337 L1200P probably damaging Het
Itgb7 C T 15: 102,222,118 V378M probably damaging Het
Krt84 T C 15: 101,529,584 E312G possibly damaging Het
Man2a2 A G 7: 80,367,784 W250R probably damaging Het
Mcam T C 9: 44,136,635 V59A probably damaging Het
Mfrp T C 9: 44,103,718 L314P probably benign Het
Mgat5 T C 1: 127,469,250 V578A probably damaging Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myh1 A C 11: 67,222,408 D1873A probably benign Het
Nek9 A G 12: 85,329,903 W235R probably damaging Het
Olfr1013 T C 2: 85,769,998 S66P probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pecr T C 1: 72,277,358 R63G possibly damaging Het
Pkhd1l1 T G 15: 44,499,982 probably null Het
Plekha5 T C 6: 140,570,403 V270A probably damaging Het
Prr14l T C 5: 32,830,702 D483G probably benign Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Senp1 C T 15: 98,058,315 V408I possibly damaging Het
Stambpl1 T A 19: 34,226,704 Y65N probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Themis T A 10: 28,668,727 I23N probably damaging Het
Thnsl1 T C 2: 21,212,533 I366T probably benign Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tmem178b A T 6: 40,207,501 Q111L probably damaging Het
Vmn1r195 C G 13: 22,278,764 L135V possibly damaging Het
Vmn2r-ps36 C T 7: 7,428,540 noncoding transcript Het
Zfp956 G A 6: 47,963,871 R388H probably damaging Het
Zfr2 T G 10: 81,242,116 V259G probably benign Het
Other mutations in Arhgap32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgap32 APN 9 32257361 missense probably benign 0.00
IGL01317:Arhgap32 APN 9 32256964 missense probably benign 0.30
IGL01614:Arhgap32 APN 9 32260505 missense probably damaging 1.00
IGL01791:Arhgap32 APN 9 32247190 missense probably damaging 0.96
IGL02318:Arhgap32 APN 9 32259331 missense probably benign 0.00
IGL02542:Arhgap32 APN 9 32255648 missense probably damaging 1.00
IGL02568:Arhgap32 APN 9 32247194 missense probably damaging 1.00
IGL02627:Arhgap32 APN 9 32246006 missense probably damaging 1.00
IGL02927:Arhgap32 APN 9 32261135 missense possibly damaging 0.95
IGL03157:Arhgap32 APN 9 32259134 missense probably damaging 1.00
IGL03286:Arhgap32 APN 9 32259520 missense probably benign 0.06
PIT4445001:Arhgap32 UTSW 9 32260856 missense probably damaging 1.00
R0004:Arhgap32 UTSW 9 32151998 missense probably damaging 0.98
R0335:Arhgap32 UTSW 9 32259760 missense probably benign 0.00
R0380:Arhgap32 UTSW 9 32246477 missense probably damaging 1.00
R0396:Arhgap32 UTSW 9 32245255 critical splice donor site probably null
R0494:Arhgap32 UTSW 9 32258903 missense probably damaging 0.98
R0508:Arhgap32 UTSW 9 32190068 splice site probably benign
R0856:Arhgap32 UTSW 9 32260220 missense probably damaging 1.00
R0990:Arhgap32 UTSW 9 32255381 missense probably damaging 1.00
R1312:Arhgap32 UTSW 9 32255312 missense probably benign
R1455:Arhgap32 UTSW 9 32260085 missense probably benign 0.08
R1515:Arhgap32 UTSW 9 32116202 missense probably benign
R1523:Arhgap32 UTSW 9 32256752 missense probably damaging 1.00
R1651:Arhgap32 UTSW 9 32259800 missense probably damaging 1.00
R1743:Arhgap32 UTSW 9 32259431 missense probably benign 0.00
R1999:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2098:Arhgap32 UTSW 9 32259911 missense probably damaging 1.00
R2256:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2257:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2989:Arhgap32 UTSW 9 32239398 missense possibly damaging 0.54
R3780:Arhgap32 UTSW 9 32152019 splice site probably null
R3793:Arhgap32 UTSW 9 32255373 missense probably damaging 1.00
R3846:Arhgap32 UTSW 9 32190024 missense probably benign 0.03
R4086:Arhgap32 UTSW 9 32247066 unclassified probably benign
R4177:Arhgap32 UTSW 9 32247214 missense probably null 1.00
R4230:Arhgap32 UTSW 9 32257474 missense probably benign 0.10
R4280:Arhgap32 UTSW 9 32259889 missense probably damaging 0.98
R4504:Arhgap32 UTSW 9 32181839 splice site probably null
R4587:Arhgap32 UTSW 9 32260945 missense probably benign 0.02
R4612:Arhgap32 UTSW 9 32259479 missense probably damaging 0.99
R4622:Arhgap32 UTSW 9 32239348 missense possibly damaging 0.75
R4670:Arhgap32 UTSW 9 32170145 missense probably benign 0.03
R4784:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4784:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4785:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4785:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4906:Arhgap32 UTSW 9 32245256 critical splice donor site probably null
R5046:Arhgap32 UTSW 9 32256799 missense probably damaging 1.00
R5360:Arhgap32 UTSW 9 32259671 missense probably damaging 1.00
R5382:Arhgap32 UTSW 9 32152010 missense probably damaging 1.00
R5445:Arhgap32 UTSW 9 32248382 missense probably benign 0.19
R5637:Arhgap32 UTSW 9 32247206 missense probably damaging 1.00
R5659:Arhgap32 UTSW 9 32181960 missense probably damaging 1.00
R5801:Arhgap32 UTSW 9 32255788 missense probably benign 0.01
R6002:Arhgap32 UTSW 9 32256979 missense probably benign 0.00
R6109:Arhgap32 UTSW 9 32260111 missense probably damaging 1.00
R6405:Arhgap32 UTSW 9 32248488 missense probably benign 0.31
R6922:Arhgap32 UTSW 9 32152687 missense possibly damaging 0.86
R7009:Arhgap32 UTSW 9 32245976 missense probably damaging 1.00
R7137:Arhgap32 UTSW 9 32151936 missense probably benign 0.32
X0027:Arhgap32 UTSW 9 32250641 critical splice acceptor site probably null
X0063:Arhgap32 UTSW 9 32261069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATATGCAGTGAGTGTGTGC -3'
(R):5'- AAGGAAAAGCTGCCCTCTTC -3'

Sequencing Primer
(F):5'- CCTGGGGTTTCCTGTCTGTAGTC -3'
(R):5'- CTGACCGAGAGAGAAGTCTTACTG -3'
Posted On2014-10-01