Incidental Mutation 'R2150:Igdcc4'
ID234202
Institutional Source Beutler Lab
Gene Symbol Igdcc4
Ensembl Gene ENSMUSG00000032816
Gene Nameimmunoglobulin superfamily, DCC subclass, member 4
SynonymsWI-18508, WI-16786, Nope, 9330155G14Rik
MMRRC Submission 040153-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R2150 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location65101486-65137940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65125335 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 542 (I542V)
Ref Sequence ENSEMBL: ENSMUSP00000150272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035499] [ENSMUST00000077696] [ENSMUST00000166273] [ENSMUST00000213533]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035499
AA Change: I542V

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045387
Gene: ENSMUSG00000032816
AA Change: I542V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 40 139 5e0 SMART
IGc2 154 218 1.3e-11 SMART
IGc2 255 318 1.13e-11 SMART
low complexity region 322 335 N/A INTRINSIC
IGc2 346 411 1.34e-13 SMART
FN3 428 511 3.58e-12 SMART
FN3 526 610 9.54e-8 SMART
FN3 630 726 7.34e-9 SMART
FN3 750 832 1.05e-9 SMART
FN3 848 932 2.14e-10 SMART
low complexity region 958 978 N/A INTRINSIC
low complexity region 1085 1100 N/A INTRINSIC
low complexity region 1154 1168 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000077696
AA Change: I589V

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000076878
Gene: ENSMUSG00000032816
AA Change: I589V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 40 139 5e0 SMART
IGc2 154 218 1.3e-11 SMART
IGc2 255 458 7.02e-8 SMART
FN3 475 558 3.58e-12 SMART
FN3 573 656 1.1e-7 SMART
FN3 676 772 7.34e-9 SMART
FN3 796 878 1.05e-9 SMART
FN3 894 978 2.14e-10 SMART
low complexity region 1004 1024 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
low complexity region 1200 1214 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166273
SMART Domains Protein: ENSMUSP00000132576
Gene: ENSMUSG00000032816

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:IG 40 83 3e-22 BLAST
low complexity region 142 156 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213423
Predicted Effect possibly damaging
Transcript: ENSMUST00000213533
AA Change: I542V

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214978
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik C T 8: 87,586,063 Q159* probably null Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Adam34 A G 8: 43,652,501 Y36H probably benign Het
Adprm A G 11: 67,038,229 V312A probably benign Het
Anapc2 T C 2: 25,272,670 L52P probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Apoc4 T A 7: 19,678,635 T62S probably damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap32 A G 9: 32,116,140 E2G possibly damaging Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccdc63 C G 5: 122,127,565 A71P possibly damaging Het
Cdca2 T C 14: 67,714,809 K38E probably damaging Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dab2 T C 15: 6,416,917 V5A probably benign Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Disp1 A G 1: 183,088,372 F828S probably damaging Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dock2 A G 11: 34,229,472 probably null Het
Dsel A T 1: 111,860,257 N849K probably benign Het
Fah A T 7: 84,594,834 I239N probably damaging Het
Flt4 T C 11: 49,645,997 Y1265H probably benign Het
Ghdc T C 11: 100,769,192 E243G probably benign Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gm6619 A G 6: 131,489,058 I40V probably benign Het
Gpld1 T C 13: 24,962,647 V225A probably benign Het
Hectd4 T C 5: 121,253,858 probably benign Het
Igsf9b T C 9: 27,334,337 L1200P probably damaging Het
Itgb7 C T 15: 102,222,118 V378M probably damaging Het
Krt84 T C 15: 101,529,584 E312G possibly damaging Het
Man2a2 A G 7: 80,367,784 W250R probably damaging Het
Mcam T C 9: 44,136,635 V59A probably damaging Het
Mfrp T C 9: 44,103,718 L314P probably benign Het
Mgat5 T C 1: 127,469,250 V578A probably damaging Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myh1 A C 11: 67,222,408 D1873A probably benign Het
Nek9 A G 12: 85,329,903 W235R probably damaging Het
Olfr1013 T C 2: 85,769,998 S66P probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pecr T C 1: 72,277,358 R63G possibly damaging Het
Pkhd1l1 T G 15: 44,499,982 probably null Het
Plekha5 T C 6: 140,570,403 V270A probably damaging Het
Prr14l T C 5: 32,830,702 D483G probably benign Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Senp1 C T 15: 98,058,315 V408I possibly damaging Het
Stambpl1 T A 19: 34,226,704 Y65N probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Themis T A 10: 28,668,727 I23N probably damaging Het
Thnsl1 T C 2: 21,212,533 I366T probably benign Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tmem178b A T 6: 40,207,501 Q111L probably damaging Het
Vmn1r195 C G 13: 22,278,764 L135V possibly damaging Het
Vmn2r-ps36 C T 7: 7,428,540 noncoding transcript Het
Zfp956 G A 6: 47,963,871 R388H probably damaging Het
Zfr2 T G 10: 81,242,116 V259G probably benign Het
Other mutations in Igdcc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Igdcc4 APN 9 65135164 missense probably damaging 1.00
IGL01285:Igdcc4 APN 9 65123991 missense probably damaging 1.00
IGL01412:Igdcc4 APN 9 65114449 splice site probably benign
IGL01485:Igdcc4 APN 9 65122607 missense probably benign 0.02
IGL01552:Igdcc4 APN 9 65122502 intron probably benign
IGL01651:Igdcc4 APN 9 65124112 missense possibly damaging 0.63
IGL01751:Igdcc4 APN 9 65131732 missense probably damaging 1.00
IGL02164:Igdcc4 APN 9 65124782 splice site probably benign
IGL02468:Igdcc4 APN 9 65126832 missense probably damaging 1.00
IGL02616:Igdcc4 APN 9 65133078 missense probably damaging 1.00
IGL02685:Igdcc4 APN 9 65133825 missense possibly damaging 0.81
IGL02734:Igdcc4 APN 9 65131456 missense possibly damaging 0.47
IGL02893:Igdcc4 APN 9 65133071 missense probably damaging 1.00
R0006:Igdcc4 UTSW 9 65135100 splice site probably benign
R0583:Igdcc4 UTSW 9 65121813 missense possibly damaging 0.85
R0939:Igdcc4 UTSW 9 65131473 critical splice donor site probably null
R1075:Igdcc4 UTSW 9 65131650 missense possibly damaging 0.90
R1110:Igdcc4 UTSW 9 65126926 missense possibly damaging 0.91
R1183:Igdcc4 UTSW 9 65121900 missense possibly damaging 0.91
R1318:Igdcc4 UTSW 9 65133690 missense probably damaging 1.00
R1507:Igdcc4 UTSW 9 65133744 missense probably damaging 1.00
R1548:Igdcc4 UTSW 9 65135227 missense probably benign 0.08
R1640:Igdcc4 UTSW 9 65122795 missense probably damaging 1.00
R1681:Igdcc4 UTSW 9 65128795 missense probably damaging 1.00
R1687:Igdcc4 UTSW 9 65131663 missense probably damaging 1.00
R1716:Igdcc4 UTSW 9 65126897 missense probably damaging 1.00
R1964:Igdcc4 UTSW 9 65122769 missense probably benign
R1996:Igdcc4 UTSW 9 65121819 missense probably damaging 1.00
R2278:Igdcc4 UTSW 9 65130743 missense probably damaging 1.00
R3085:Igdcc4 UTSW 9 65132058 missense probably damaging 1.00
R4011:Igdcc4 UTSW 9 65135479 missense probably benign
R4077:Igdcc4 UTSW 9 65131765 missense probably damaging 1.00
R4191:Igdcc4 UTSW 9 65124151 missense probably benign 0.13
R4293:Igdcc4 UTSW 9 65124610 critical splice acceptor site probably null
R4589:Igdcc4 UTSW 9 65130628 missense probably damaging 1.00
R4931:Igdcc4 UTSW 9 65124015 missense possibly damaging 0.66
R5093:Igdcc4 UTSW 9 65122757 missense possibly damaging 0.51
R5106:Igdcc4 UTSW 9 65124701 missense probably damaging 1.00
R5546:Igdcc4 UTSW 9 65128795 missense probably damaging 1.00
R5634:Igdcc4 UTSW 9 65134546 missense probably benign 0.18
R5810:Igdcc4 UTSW 9 65128695 missense probably damaging 1.00
R6395:Igdcc4 UTSW 9 65135118 missense probably damaging 1.00
R6475:Igdcc4 UTSW 9 65120321 missense probably damaging 1.00
R6776:Igdcc4 UTSW 9 65135418 missense probably benign 0.02
R6828:Igdcc4 UTSW 9 65122697 missense probably benign
R6914:Igdcc4 UTSW 9 65120268 missense probably benign 0.00
R6942:Igdcc4 UTSW 9 65120268 missense probably benign 0.00
R7072:Igdcc4 UTSW 9 65130731 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTGGGATAGAAAGGATGTCTC -3'
(R):5'- TAGGCTCCACTTCCACTGAC -3'

Sequencing Primer
(F):5'- TCCGCATCCTCCAGCGTAG -3'
(R):5'- TGACAACGTCCCTCATCTAGG -3'
Posted On2014-10-01