Incidental Mutation 'R2150:Anxa2'
List |< first << previous [record 95 of 1259] next >> last >|
ID234203
Institutional Source Beutler Lab
Gene Symbol Anxa2
Ensembl Gene ENSMUSG00000032231
Gene Nameannexin A2
Synonymslipocortin II, annexin II, Cal1h, 36-kDa calelectrin
MMRRC Submission 040153-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2150 (G1)
Quality Score212
Status Validated
Chromosome9
Chromosomal Location69453620-69491795 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCCC to TCC at 69489754 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034756] [ENSMUST00000123470] [ENSMUST00000136282]
Predicted Effect probably null
Transcript: ENSMUST00000034756
SMART Domains Protein: ENSMUSP00000034756
Gene: ENSMUSG00000032231

DomainStartEndE-ValueType
ANX 50 102 5.79e-20 SMART
ANX 122 174 1.5e-27 SMART
ANX 207 259 8.2e-11 SMART
ANX 282 334 1.6e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123470
SMART Domains Protein: ENSMUSP00000122175
Gene: ENSMUSG00000032231

DomainStartEndE-ValueType
ANX 50 102 5.79e-20 SMART
ANX 122 174 1.5e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000136282
SMART Domains Protein: ENSMUSP00000117855
Gene: ENSMUSG00000032231

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
ANX 55 107 1.5e-27 SMART
ANX 140 192 8.2e-11 SMART
ANX 215 267 1.6e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154591
Meta Mutation Damage Score 0.6384 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. This protein functions as an autocrine factor which heightens osteoclast formation and bone resorption. This gene has three pseudogenes located on chromosomes 4, 9 and 10, respectively. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are viable and fertile but suffer from growth deficits, impaired angiogenesis, and increased susceptibility to thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik C T 8: 87,586,063 Q159* probably null Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Adam34 A G 8: 43,652,501 Y36H probably benign Het
Adprm A G 11: 67,038,229 V312A probably benign Het
Anapc2 T C 2: 25,272,670 L52P probably benign Het
Apoc4 T A 7: 19,678,635 T62S probably damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap32 A G 9: 32,116,140 E2G possibly damaging Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccdc63 C G 5: 122,127,565 A71P possibly damaging Het
Cdca2 T C 14: 67,714,809 K38E probably damaging Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dab2 T C 15: 6,416,917 V5A probably benign Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Disp1 A G 1: 183,088,372 F828S probably damaging Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dock2 A G 11: 34,229,472 probably null Het
Dsel A T 1: 111,860,257 N849K probably benign Het
Fah A T 7: 84,594,834 I239N probably damaging Het
Flt4 T C 11: 49,645,997 Y1265H probably benign Het
Ghdc T C 11: 100,769,192 E243G probably benign Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gm6619 A G 6: 131,489,058 I40V probably benign Het
Gpld1 T C 13: 24,962,647 V225A probably benign Het
Hectd4 T C 5: 121,253,858 probably benign Het
Igdcc4 A G 9: 65,125,335 I542V possibly damaging Het
Igsf9b T C 9: 27,334,337 L1200P probably damaging Het
Itgb7 C T 15: 102,222,118 V378M probably damaging Het
Krt84 T C 15: 101,529,584 E312G possibly damaging Het
Man2a2 A G 7: 80,367,784 W250R probably damaging Het
Mcam T C 9: 44,136,635 V59A probably damaging Het
Mfrp T C 9: 44,103,718 L314P probably benign Het
Mgat5 T C 1: 127,469,250 V578A probably damaging Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myh1 A C 11: 67,222,408 D1873A probably benign Het
Nek9 A G 12: 85,329,903 W235R probably damaging Het
Olfr1013 T C 2: 85,769,998 S66P probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pecr T C 1: 72,277,358 R63G possibly damaging Het
Pkhd1l1 T G 15: 44,499,982 probably null Het
Plekha5 T C 6: 140,570,403 V270A probably damaging Het
Prr14l T C 5: 32,830,702 D483G probably benign Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Senp1 C T 15: 98,058,315 V408I possibly damaging Het
Stambpl1 T A 19: 34,226,704 Y65N probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Themis T A 10: 28,668,727 I23N probably damaging Het
Thnsl1 T C 2: 21,212,533 I366T probably benign Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tmem178b A T 6: 40,207,501 Q111L probably damaging Het
Vmn1r195 C G 13: 22,278,764 L135V possibly damaging Het
Vmn2r-ps36 C T 7: 7,428,540 noncoding transcript Het
Zfp956 G A 6: 47,963,871 R388H probably damaging Het
Zfr2 T G 10: 81,242,116 V259G probably benign Het
Other mutations in Anxa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Anxa2 APN 9 69483019 nonsense probably null
IGL02550:Anxa2 APN 9 69467306 missense probably benign 0.00
FR4342:Anxa2 UTSW 9 69480205 small insertion probably benign
FR4342:Anxa2 UTSW 9 69480210 small insertion probably benign
FR4548:Anxa2 UTSW 9 69480203 small insertion probably benign
FR4589:Anxa2 UTSW 9 69480210 small insertion probably benign
R1480:Anxa2 UTSW 9 69489754 frame shift probably null
R1482:Anxa2 UTSW 9 69489754 frame shift probably null
R1519:Anxa2 UTSW 9 69485241 missense probably damaging 1.00
R1609:Anxa2 UTSW 9 69489754 frame shift probably null
R1610:Anxa2 UTSW 9 69489754 frame shift probably null
R1624:Anxa2 UTSW 9 69479708 missense probably benign 0.10
R1672:Anxa2 UTSW 9 69489754 frame shift probably null
R1696:Anxa2 UTSW 9 69489754 frame shift probably null
R1760:Anxa2 UTSW 9 69489767 missense probably benign 0.00
R1775:Anxa2 UTSW 9 69488081 missense possibly damaging 0.93
R1828:Anxa2 UTSW 9 69482978 missense probably damaging 1.00
R1884:Anxa2 UTSW 9 69489754 frame shift probably null
R1991:Anxa2 UTSW 9 69483816 missense probably damaging 1.00
R2020:Anxa2 UTSW 9 69483817 missense probably damaging 0.99
R2029:Anxa2 UTSW 9 69464480 missense possibly damaging 0.71
R2103:Anxa2 UTSW 9 69483816 missense probably damaging 1.00
R2129:Anxa2 UTSW 9 69476128 missense possibly damaging 0.48
R2146:Anxa2 UTSW 9 69489754 frame shift probably null
R2148:Anxa2 UTSW 9 69489754 frame shift probably null
R2149:Anxa2 UTSW 9 69489754 frame shift probably null
R2437:Anxa2 UTSW 9 69489764 missense probably damaging 1.00
R3848:Anxa2 UTSW 9 69467342 missense probably damaging 1.00
R4036:Anxa2 UTSW 9 69488070 missense probably damaging 0.99
R4565:Anxa2 UTSW 9 69489737 missense probably damaging 1.00
R4731:Anxa2 UTSW 9 69486530 missense probably benign 0.41
R5172:Anxa2 UTSW 9 69485251 missense probably damaging 0.99
R5181:Anxa2 UTSW 9 69476065 missense probably benign 0.00
R6427:Anxa2 UTSW 9 69476149 critical splice donor site probably null
R6759:Anxa2 UTSW 9 69483821 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCACGACCCACATGAGTG -3'
(R):5'- AGGTCACCACTCTGCCATTG -3'

Sequencing Primer
(F):5'- CAGCTTTAGGGGATCTGACACTC -3'
(R):5'- GCCATTGTTCTCTACAGCCAC -3'
Posted On2014-10-01