Incidental Mutation 'R2150:Dennd3'
ID234222
Institutional Source Beutler Lab
Gene Symbol Dennd3
Ensembl Gene ENSMUSG00000036661
Gene NameDENN/MADD domain containing 3
SynonymsE030003N15Rik
MMRRC Submission 040153-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R2150 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location73512560-73572242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73555060 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 762 (H762L)
Ref Sequence ENSEMBL: ENSMUSP00000134002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043414] [ENSMUST00000160267] [ENSMUST00000173292]
Predicted Effect probably benign
Transcript: ENSMUST00000043414
AA Change: H762L

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000046774
Gene: ENSMUSG00000036661
AA Change: H762L

DomainStartEndE-ValueType
Blast:uDENN 12 161 3e-78 BLAST
DENN 187 373 1.54e-62 SMART
dDENN 436 499 6.81e-14 SMART
WD40 1015 1054 3.68e1 SMART
WD40 1057 1098 3.32e-5 SMART
WD40 1232 1272 1.1e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160267
SMART Domains Protein: ENSMUSP00000124538
Gene: ENSMUSG00000036661

DomainStartEndE-ValueType
Blast:WD40 51 90 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162488
SMART Domains Protein: ENSMUSP00000125657
Gene: ENSMUSG00000036661

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Blast:DENN 33 104 5e-28 BLAST
DENN 116 302 1.54e-62 SMART
dDENN 312 376 5.63e-6 SMART
WD40 892 931 3.68e1 SMART
WD40 934 975 3.32e-5 SMART
WD40 1109 1149 1.1e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173292
AA Change: H762L

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134002
Gene: ENSMUSG00000036661
AA Change: H762L

DomainStartEndE-ValueType
Blast:uDENN 12 161 2e-78 BLAST
DENN 187 373 1.54e-62 SMART
dDENN 436 499 6.81e-14 SMART
WD40 1015 1054 3.68e1 SMART
WD40 1057 1098 3.32e-5 SMART
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik C T 8: 87,586,063 Q159* probably null Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Adam34 A G 8: 43,652,501 Y36H probably benign Het
Adprm A G 11: 67,038,229 V312A probably benign Het
Anapc2 T C 2: 25,272,670 L52P probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Apoc4 T A 7: 19,678,635 T62S probably damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap32 A G 9: 32,116,140 E2G possibly damaging Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccdc63 C G 5: 122,127,565 A71P possibly damaging Het
Cdca2 T C 14: 67,714,809 K38E probably damaging Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dab2 T C 15: 6,416,917 V5A probably benign Het
Disp1 A G 1: 183,088,372 F828S probably damaging Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dock2 A G 11: 34,229,472 probably null Het
Dsel A T 1: 111,860,257 N849K probably benign Het
Fah A T 7: 84,594,834 I239N probably damaging Het
Flt4 T C 11: 49,645,997 Y1265H probably benign Het
Ghdc T C 11: 100,769,192 E243G probably benign Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gm6619 A G 6: 131,489,058 I40V probably benign Het
Gpld1 T C 13: 24,962,647 V225A probably benign Het
Hectd4 T C 5: 121,253,858 probably benign Het
Igdcc4 A G 9: 65,125,335 I542V possibly damaging Het
Igsf9b T C 9: 27,334,337 L1200P probably damaging Het
Itgb7 C T 15: 102,222,118 V378M probably damaging Het
Krt84 T C 15: 101,529,584 E312G possibly damaging Het
Man2a2 A G 7: 80,367,784 W250R probably damaging Het
Mcam T C 9: 44,136,635 V59A probably damaging Het
Mfrp T C 9: 44,103,718 L314P probably benign Het
Mgat5 T C 1: 127,469,250 V578A probably damaging Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myh1 A C 11: 67,222,408 D1873A probably benign Het
Nek9 A G 12: 85,329,903 W235R probably damaging Het
Olfr1013 T C 2: 85,769,998 S66P probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pecr T C 1: 72,277,358 R63G possibly damaging Het
Pkhd1l1 T G 15: 44,499,982 probably null Het
Plekha5 T C 6: 140,570,403 V270A probably damaging Het
Prr14l T C 5: 32,830,702 D483G probably benign Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Senp1 C T 15: 98,058,315 V408I possibly damaging Het
Stambpl1 T A 19: 34,226,704 Y65N probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Themis T A 10: 28,668,727 I23N probably damaging Het
Thnsl1 T C 2: 21,212,533 I366T probably benign Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tmem178b A T 6: 40,207,501 Q111L probably damaging Het
Vmn1r195 C G 13: 22,278,764 L135V possibly damaging Het
Vmn2r-ps36 C T 7: 7,428,540 noncoding transcript Het
Zfp956 G A 6: 47,963,871 R388H probably damaging Het
Zfr2 T G 10: 81,242,116 V259G probably benign Het
Other mutations in Dennd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dennd3 APN 15 73567133 missense probably benign 0.26
IGL00579:Dennd3 APN 15 73540842 missense possibly damaging 0.63
IGL02101:Dennd3 APN 15 73527945 missense possibly damaging 0.81
IGL02164:Dennd3 APN 15 73544448 missense probably benign 0.26
IGL02389:Dennd3 APN 15 73567056 missense probably damaging 1.00
IGL02604:Dennd3 APN 15 73556403 missense probably damaging 1.00
IGL02697:Dennd3 APN 15 73524236 missense possibly damaging 0.82
IGL02885:Dennd3 APN 15 73568696 missense probably benign
IGL03356:Dennd3 APN 15 73568633 missense probably benign 0.19
IGL03388:Dennd3 APN 15 73544359 missense probably damaging 0.98
R0118:Dennd3 UTSW 15 73565076 missense probably damaging 1.00
R0925:Dennd3 UTSW 15 73533435 missense probably damaging 1.00
R1076:Dennd3 UTSW 15 73540733 missense probably damaging 1.00
R1355:Dennd3 UTSW 15 73540854 splice site probably benign
R1370:Dennd3 UTSW 15 73540854 splice site probably benign
R1480:Dennd3 UTSW 15 73532846 missense probably benign 0.20
R1727:Dennd3 UTSW 15 73565128 missense possibly damaging 0.95
R1732:Dennd3 UTSW 15 73537418 splice site probably benign
R1771:Dennd3 UTSW 15 73555101 missense possibly damaging 0.71
R1776:Dennd3 UTSW 15 73555101 missense possibly damaging 0.71
R1779:Dennd3 UTSW 15 73522508 critical splice donor site probably null
R1838:Dennd3 UTSW 15 73565100 missense probably damaging 1.00
R2146:Dennd3 UTSW 15 73523496 missense probably damaging 1.00
R2146:Dennd3 UTSW 15 73555060 missense probably benign 0.35
R2147:Dennd3 UTSW 15 73523487 missense probably damaging 1.00
R2148:Dennd3 UTSW 15 73555060 missense probably benign 0.35
R2149:Dennd3 UTSW 15 73555060 missense probably benign 0.35
R2174:Dennd3 UTSW 15 73555305 missense probably damaging 1.00
R2295:Dennd3 UTSW 15 73523555 critical splice donor site probably null
R2905:Dennd3 UTSW 15 73557646 missense probably damaging 1.00
R3106:Dennd3 UTSW 15 73565124 nonsense probably null
R3757:Dennd3 UTSW 15 73522234 missense probably benign 0.00
R3785:Dennd3 UTSW 15 73547577 missense possibly damaging 0.89
R3786:Dennd3 UTSW 15 73547577 missense possibly damaging 0.89
R3787:Dennd3 UTSW 15 73547577 missense possibly damaging 0.89
R3847:Dennd3 UTSW 15 73542732 missense possibly damaging 0.64
R4369:Dennd3 UTSW 15 73540809 missense probably damaging 0.98
R4601:Dennd3 UTSW 15 73567160 missense probably damaging 0.99
R4666:Dennd3 UTSW 15 73570860 missense probably damaging 1.00
R4680:Dennd3 UTSW 15 73533376 missense possibly damaging 0.82
R4708:Dennd3 UTSW 15 73523495 missense probably damaging 1.00
R4789:Dennd3 UTSW 15 73522282 missense probably damaging 1.00
R4920:Dennd3 UTSW 15 73540725 missense probably benign 0.13
R5043:Dennd3 UTSW 15 73527936 missense probably benign 0.00
R5074:Dennd3 UTSW 15 73547295 missense probably damaging 1.00
R5410:Dennd3 UTSW 15 73547448 missense probably benign 0.02
R5421:Dennd3 UTSW 15 73567115 missense probably benign
R5560:Dennd3 UTSW 15 73532895 missense probably damaging 1.00
R6008:Dennd3 UTSW 15 73567080 missense possibly damaging 0.88
R6357:Dennd3 UTSW 15 73556472 missense possibly damaging 0.49
R6563:Dennd3 UTSW 15 73544380 missense probably damaging 0.98
R6687:Dennd3 UTSW 15 73556366 missense possibly damaging 0.64
R6837:Dennd3 UTSW 15 73557693 missense probably damaging 1.00
R6910:Dennd3 UTSW 15 73555116 missense probably benign 0.01
R7125:Dennd3 UTSW 15 73533291 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TAAGTCAGATTGCCCTCGC -3'
(R):5'- AGCAAGAACAGGCGCTTCTG -3'

Sequencing Primer
(F):5'- AGATTGCCCTCGCTCTGAG -3'
(R):5'- ACAGGCGCTTCTGGGTCATG -3'
Posted On2014-10-01