Incidental Mutation 'R2151:Magi3'
ID234248
Institutional Source Beutler Lab
Gene Symbol Magi3
Ensembl Gene ENSMUSG00000052539
Gene Namemembrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms4732496O19Rik, 6530407C02Rik
MMRRC Submission 040154-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock #R2151 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location104013259-104220374 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104085238 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 306 (Y306C)
Ref Sequence ENSEMBL: ENSMUSP00000113713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064371] [ENSMUST00000121198] [ENSMUST00000122303]
Predicted Effect probably damaging
Transcript: ENSMUST00000064371
AA Change: Y306C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067932
Gene: ENSMUSG00000052539
AA Change: Y306C

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121198
AA Change: Y306C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112934
Gene: ENSMUSG00000052539
AA Change: Y306C

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122303
AA Change: Y306C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113713
Gene: ENSMUSG00000052539
AA Change: Y306C

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (91/91)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,478,875 V47I possibly damaging Het
4930447C04Rik T C 12: 72,907,951 probably null Het
4930579F01Rik A G 3: 138,176,456 probably null Het
Abhd17c G T 7: 84,151,455 H130Q probably damaging Het
Actr10 T A 12: 70,940,801 C27* probably null Het
AF529169 T G 9: 89,602,168 K392T possibly damaging Het
Als2 G A 1: 59,207,789 H564Y probably damaging Het
Art5 A G 7: 102,098,200 L124P possibly damaging Het
Asap2 A T 12: 21,112,083 T14S probably damaging Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Bicd2 G T 13: 49,379,576 C546F probably damaging Het
Cnbp C T 6: 87,845,299 G81D probably damaging Het
Dnah5 T C 15: 28,444,091 Y4012H probably damaging Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Drc3 A T 11: 60,375,157 E224V probably benign Het
Ehd2 T C 7: 15,952,203 K315E probably damaging Het
Eif6 A T 2: 155,822,890 N225K probably benign Het
Epg5 T C 18: 78,027,302 V2264A probably benign Het
Faf2 T C 13: 54,648,407 F126L probably damaging Het
Fam71b A T 11: 46,405,331 K177* probably null Het
Fiz1 T C 7: 5,012,881 S37G possibly damaging Het
Frs3 T C 17: 47,703,062 S227P probably benign Het
Gm21188 C T 13: 120,034,799 C178Y unknown Het
Gm4787 T A 12: 81,377,219 I722F probably benign Het
Gm6370 T A 5: 146,493,641 L212Q probably damaging Het
Gmnc G A 16: 26,960,706 H142Y possibly damaging Het
Gna15 T C 10: 81,502,904 Y367C probably damaging Het
Gpr158 G A 2: 21,827,514 V1142M possibly damaging Het
Gpx6 A G 13: 21,318,971 K185R probably damaging Het
Hc A C 2: 34,991,103 probably benign Het
Hdac9 A G 12: 34,390,256 S375P probably damaging Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Klre1 G A 6: 129,580,033 E33K possibly damaging Het
Ldhb C A 6: 142,498,670 V86L possibly damaging Het
Mmp17 T C 5: 129,605,661 Y455H probably benign Het
Mmp25 T A 17: 23,631,074 Y504F probably damaging Het
Myo1a T C 10: 127,720,181 I969T probably benign Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nf1 T A 11: 79,447,570 M1136K possibly damaging Het
Nmi T C 2: 51,952,543 E179G probably damaging Het
Nov G A 15: 54,752,458 A340T probably benign Het
Nrros A T 16: 32,143,258 M611K probably benign Het
Nsd1 A T 13: 55,291,236 N1692I probably damaging Het
Nuak1 T C 10: 84,409,645 N112S probably benign Het
Odf2l T C 3: 145,149,024 Y488H possibly damaging Het
Olfr1204 C A 2: 88,852,784 P278H probably damaging Het
Olfr935 T A 9: 38,994,716 T240S probably damaging Het
Olfr948 T A 9: 39,319,117 I166F probably damaging Het
Otop2 A G 11: 115,329,411 D359G possibly damaging Het
Pi4ka A T 16: 17,367,507 F243Y probably benign Het
Pnmal2 T C 7: 16,945,912 C274R probably benign Het
Ppp1r42 A G 1: 10,003,347 V6A probably benign Het
Prrg4 A G 2: 104,839,388 L128S probably damaging Het
Prss33 C T 17: 23,834,843 V87M probably damaging Het
Psen2 A G 1: 180,233,664 V278A probably damaging Het
Ptpn13 C A 5: 103,525,785 T538K probably damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Rbak A C 5: 143,176,502 D35E possibly damaging Het
Rbms1 C A 2: 60,762,048 probably null Het
Rgs7bp T A 13: 104,964,089 N226I probably damaging Het
Rnf182 T A 13: 43,668,423 V150E probably benign Het
Sacs A G 14: 61,209,640 Y3045C probably damaging Het
Scp2 G T 4: 108,063,944 A23E probably benign Het
Sec16a A T 2: 26,413,745 probably benign Het
Slc30a5 A T 13: 100,803,949 H619Q probably damaging Het
Slfn10-ps T A 11: 83,035,685 noncoding transcript Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Slx T A X: 26,534,389 probably benign Het
Spns3 C A 11: 72,545,961 probably benign Het
Stxbp1 T A 2: 32,802,856 I383F probably damaging Het
Taf3 C T 2: 9,951,566 E597K possibly damaging Het
Tbcd A G 11: 121,603,631 Q1006R possibly damaging Het
Tenm4 G T 7: 96,902,847 V2498F probably damaging Het
Tex2 T C 11: 106,567,335 probably benign Het
Tkfc A T 19: 10,599,057 L154Q probably damaging Het
Tmem57 A G 4: 134,811,223 V470A probably benign Het
Tmem62 A G 2: 120,986,862 H257R probably damaging Het
Trpm2 T C 10: 77,932,179 I829V probably benign Het
Ttc38 A G 15: 85,851,601 probably null Het
Ttn A T 2: 76,718,413 Y30135* probably null Het
Ttn A G 2: 76,980,133 V17A probably benign Het
Ubqlnl A T 7: 104,148,683 C536S probably benign Het
Vmn1r230 T A 17: 20,846,801 M84K probably damaging Het
Vmn1r235 G A 17: 21,262,366 V318I probably benign Het
Vmn2r76 T C 7: 86,230,484 I203V probably benign Het
Vmn2r97 A T 17: 18,947,322 R613* probably null Het
Zfp180 A G 7: 24,105,260 H368R probably damaging Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Zfyve27 G T 19: 42,171,731 R62L probably benign Het
Other mutations in Magi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Magi3 APN 3 104014978 missense probably damaging 1.00
IGL00933:Magi3 APN 3 104015847 missense probably benign
IGL01151:Magi3 APN 3 104051374 missense probably damaging 1.00
IGL01674:Magi3 APN 3 104105721 splice site probably benign
IGL01790:Magi3 APN 3 104085244 missense probably damaging 1.00
IGL01903:Magi3 APN 3 104051210 missense possibly damaging 0.87
IGL01939:Magi3 APN 3 104054462 missense probably damaging 0.99
IGL02142:Magi3 APN 3 104015903 missense probably benign 0.32
IGL02183:Magi3 APN 3 104085347 missense probably benign 0.01
IGL02887:Magi3 APN 3 104095157 missense probably damaging 1.00
IGL03071:Magi3 APN 3 104015886 missense possibly damaging 0.51
IGL03085:Magi3 APN 3 104015339 missense possibly damaging 0.88
IGL03192:Magi3 APN 3 104043246 missense probably damaging 1.00
IGL03204:Magi3 APN 3 104105835 missense probably damaging 1.00
IGL03227:Magi3 APN 3 104051119 missense probably benign
IGL03388:Magi3 APN 3 104015841 missense probably benign 0.30
R0092:Magi3 UTSW 3 104050964 nonsense probably null
R0514:Magi3 UTSW 3 104015022 missense probably damaging 1.00
R0569:Magi3 UTSW 3 104016042 missense probably benign 0.43
R0608:Magi3 UTSW 3 104017557 missense probably damaging 1.00
R0920:Magi3 UTSW 3 104034191 splice site probably null
R1173:Magi3 UTSW 3 104061630 critical splice donor site probably null
R1256:Magi3 UTSW 3 104027810 missense probably benign 0.08
R1391:Magi3 UTSW 3 104015058 nonsense probably null
R1559:Magi3 UTSW 3 104046853 splice site probably benign
R1568:Magi3 UTSW 3 104089527 missense probably benign 0.02
R1631:Magi3 UTSW 3 104051177 missense probably benign 0.05
R1747:Magi3 UTSW 3 104034173 missense possibly damaging 0.82
R1930:Magi3 UTSW 3 104089604 missense probably damaging 1.00
R1964:Magi3 UTSW 3 104020402 missense probably damaging 0.99
R2151:Magi3 UTSW 3 104046882 missense probably damaging 1.00
R2266:Magi3 UTSW 3 104021066 intron probably benign
R2267:Magi3 UTSW 3 104021066 intron probably benign
R2268:Magi3 UTSW 3 104021066 intron probably benign
R2519:Magi3 UTSW 3 104015765 missense probably benign 0.00
R3104:Magi3 UTSW 3 104051320 missense probably damaging 0.99
R3105:Magi3 UTSW 3 104051320 missense probably damaging 0.99
R3619:Magi3 UTSW 3 104054405 missense probably damaging 1.00
R4158:Magi3 UTSW 3 104050961 missense probably damaging 1.00
R4160:Magi3 UTSW 3 104050961 missense probably damaging 1.00
R4284:Magi3 UTSW 3 104015868 nonsense probably null
R4285:Magi3 UTSW 3 104015868 nonsense probably null
R4397:Magi3 UTSW 3 104219714 missense probably damaging 1.00
R4512:Magi3 UTSW 3 104089555 missense probably damaging 0.99
R4676:Magi3 UTSW 3 104015825 missense probably benign
R4758:Magi3 UTSW 3 104015321 missense probably benign 0.01
R4940:Magi3 UTSW 3 104051392 missense probably damaging 1.00
R5039:Magi3 UTSW 3 104105791 missense probably damaging 1.00
R5160:Magi3 UTSW 3 104027908 missense possibly damaging 0.46
R5422:Magi3 UTSW 3 104051368 missense probably damaging 1.00
R5509:Magi3 UTSW 3 104015502 missense probably benign 0.00
R5839:Magi3 UTSW 3 104219731 missense probably damaging 1.00
R5924:Magi3 UTSW 3 104054538 splice site probably null
R6018:Magi3 UTSW 3 104105812 missense probably damaging 1.00
R6189:Magi3 UTSW 3 104050865 missense probably damaging 1.00
R6235:Magi3 UTSW 3 104016068 missense probably damaging 0.99
R6244:Magi3 UTSW 3 104015697 missense probably benign 0.16
R6258:Magi3 UTSW 3 104089596 missense probably damaging 1.00
R6358:Magi3 UTSW 3 104050952 missense probably damaging 1.00
R6534:Magi3 UTSW 3 104085220 missense possibly damaging 0.75
R6806:Magi3 UTSW 3 104046969 missense possibly damaging 0.94
R6816:Magi3 UTSW 3 104089911 intron probably null
R6897:Magi3 UTSW 3 104089557 missense probably damaging 1.00
X0026:Magi3 UTSW 3 104020420 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGAAAGCTTAGAGATATTGGCATG -3'
(R):5'- GCCATTCTGTTTTCAACAATGACAG -3'

Sequencing Primer
(F):5'- GCTTAGAGATATTGGCATGAGTAATC -3'
(R):5'- CAGAAACTAGAGAGATGCATTCTG -3'
Posted On2014-10-01