Incidental Mutation 'R2151:Ptpn13'
ID234257
Institutional Source Beutler Lab
Gene Symbol Ptpn13
Ensembl Gene ENSMUSG00000034573
Gene Nameprotein tyrosine phosphatase, non-receptor type 13
SynonymsPTPL1, Ptpri, PTP-BL
MMRRC Submission 040154-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R2151 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location103425192-103598303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 103525785 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 538 (T538K)
Ref Sequence ENSEMBL: ENSMUSP00000048119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048957] [ENSMUST00000196014]
Predicted Effect probably damaging
Transcript: ENSMUST00000048957
AA Change: T538K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048119
Gene: ENSMUSG00000034573
AA Change: T538K

DomainStartEndE-ValueType
KIND 3 190 2.3e-80 SMART
Blast:B41 340 447 6e-34 BLAST
coiled coil region 460 487 N/A INTRINSIC
B41 561 774 3.3e-68 SMART
FERM_C 780 869 3.2e-35 SMART
low complexity region 1049 1058 N/A INTRINSIC
PDZ 1093 1170 7.6e-25 SMART
low complexity region 1224 1236 N/A INTRINSIC
low complexity region 1309 1322 N/A INTRINSIC
low complexity region 1331 1341 N/A INTRINSIC
PDZ 1365 1442 1.7e-24 SMART
low complexity region 1450 1468 N/A INTRINSIC
PDZ 1499 1579 3.5e-19 SMART
PDZ 1773 1845 1.2e-21 SMART
PDZ 1867 1942 1.6e-16 SMART
low complexity region 2123 2134 N/A INTRINSIC
PTPc 2179 2436 6.9e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196014
SMART Domains Protein: ENSMUSP00000143571
Gene: ENSMUSG00000034573

DomainStartEndE-ValueType
KIND 3 190 2.3e-80 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200581
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP is a large intracellular protein. It has a catalytic PTP domain at its C-terminus and two major structural domains: a region with five PDZ domains and a FERM domain that binds to plasma membrane and cytoskeletal elements. This PTP was found to interact with, and dephosphorylate, Fas receptor and IkappaBalpha through the PDZ domains. This suggests it has a role in Fas mediated programmed cell death. This PTP was also shown to interact with GTPase-activating protein, and thus may function as a regulator of Rho signaling pathways. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal T-helper cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,478,875 V47I possibly damaging Het
4930447C04Rik T C 12: 72,907,951 probably null Het
4930579F01Rik A G 3: 138,176,456 probably null Het
Abhd17c G T 7: 84,151,455 H130Q probably damaging Het
Actr10 T A 12: 70,940,801 C27* probably null Het
AF529169 T G 9: 89,602,168 K392T possibly damaging Het
Als2 G A 1: 59,207,789 H564Y probably damaging Het
Art5 A G 7: 102,098,200 L124P possibly damaging Het
Asap2 A T 12: 21,112,083 T14S probably damaging Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Bicd2 G T 13: 49,379,576 C546F probably damaging Het
Cnbp C T 6: 87,845,299 G81D probably damaging Het
Dnah5 T C 15: 28,444,091 Y4012H probably damaging Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Drc3 A T 11: 60,375,157 E224V probably benign Het
Ehd2 T C 7: 15,952,203 K315E probably damaging Het
Eif6 A T 2: 155,822,890 N225K probably benign Het
Epg5 T C 18: 78,027,302 V2264A probably benign Het
Faf2 T C 13: 54,648,407 F126L probably damaging Het
Fam71b A T 11: 46,405,331 K177* probably null Het
Fiz1 T C 7: 5,012,881 S37G possibly damaging Het
Frs3 T C 17: 47,703,062 S227P probably benign Het
Gm21188 C T 13: 120,034,799 C178Y unknown Het
Gm4787 T A 12: 81,377,219 I722F probably benign Het
Gm6370 T A 5: 146,493,641 L212Q probably damaging Het
Gmnc G A 16: 26,960,706 H142Y possibly damaging Het
Gna15 T C 10: 81,502,904 Y367C probably damaging Het
Gpr158 G A 2: 21,827,514 V1142M possibly damaging Het
Gpx6 A G 13: 21,318,971 K185R probably damaging Het
Hc A C 2: 34,991,103 probably benign Het
Hdac9 A G 12: 34,390,256 S375P probably damaging Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Klre1 G A 6: 129,580,033 E33K possibly damaging Het
Ldhb C A 6: 142,498,670 V86L possibly damaging Het
Magi3 T A 3: 104,046,882 K713I probably damaging Het
Magi3 T C 3: 104,085,238 Y306C probably damaging Het
Mmp17 T C 5: 129,605,661 Y455H probably benign Het
Mmp25 T A 17: 23,631,074 Y504F probably damaging Het
Myo1a T C 10: 127,720,181 I969T probably benign Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nf1 T A 11: 79,447,570 M1136K possibly damaging Het
Nmi T C 2: 51,952,543 E179G probably damaging Het
Nov G A 15: 54,752,458 A340T probably benign Het
Nrros A T 16: 32,143,258 M611K probably benign Het
Nsd1 A T 13: 55,291,236 N1692I probably damaging Het
Nuak1 T C 10: 84,409,645 N112S probably benign Het
Odf2l T C 3: 145,149,024 Y488H possibly damaging Het
Olfr1204 C A 2: 88,852,784 P278H probably damaging Het
Olfr935 T A 9: 38,994,716 T240S probably damaging Het
Olfr948 T A 9: 39,319,117 I166F probably damaging Het
Otop2 A G 11: 115,329,411 D359G possibly damaging Het
Pi4ka A T 16: 17,367,507 F243Y probably benign Het
Pnmal2 T C 7: 16,945,912 C274R probably benign Het
Ppp1r42 A G 1: 10,003,347 V6A probably benign Het
Prrg4 A G 2: 104,839,388 L128S probably damaging Het
Prss33 C T 17: 23,834,843 V87M probably damaging Het
Psen2 A G 1: 180,233,664 V278A probably damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Rbak A C 5: 143,176,502 D35E possibly damaging Het
Rbms1 C A 2: 60,762,048 probably null Het
Rgs7bp T A 13: 104,964,089 N226I probably damaging Het
Rnf182 T A 13: 43,668,423 V150E probably benign Het
Sacs A G 14: 61,209,640 Y3045C probably damaging Het
Scp2 G T 4: 108,063,944 A23E probably benign Het
Sec16a A T 2: 26,413,745 probably benign Het
Slc30a5 A T 13: 100,803,949 H619Q probably damaging Het
Slfn10-ps T A 11: 83,035,685 noncoding transcript Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Slx T A X: 26,534,389 probably benign Het
Spns3 C A 11: 72,545,961 probably benign Het
Stxbp1 T A 2: 32,802,856 I383F probably damaging Het
Taf3 C T 2: 9,951,566 E597K possibly damaging Het
Tbcd A G 11: 121,603,631 Q1006R possibly damaging Het
Tenm4 G T 7: 96,902,847 V2498F probably damaging Het
Tex2 T C 11: 106,567,335 probably benign Het
Tkfc A T 19: 10,599,057 L154Q probably damaging Het
Tmem57 A G 4: 134,811,223 V470A probably benign Het
Tmem62 A G 2: 120,986,862 H257R probably damaging Het
Trpm2 T C 10: 77,932,179 I829V probably benign Het
Ttc38 A G 15: 85,851,601 probably null Het
Ttn A T 2: 76,718,413 Y30135* probably null Het
Ttn A G 2: 76,980,133 V17A probably benign Het
Ubqlnl A T 7: 104,148,683 C536S probably benign Het
Vmn1r230 T A 17: 20,846,801 M84K probably damaging Het
Vmn1r235 G A 17: 21,262,366 V318I probably benign Het
Vmn2r76 T C 7: 86,230,484 I203V probably benign Het
Vmn2r97 A T 17: 18,947,322 R613* probably null Het
Zfp180 A G 7: 24,105,260 H368R probably damaging Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Zfyve27 G T 19: 42,171,731 R62L probably benign Het
Other mutations in Ptpn13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ptpn13 APN 5 103551058 missense probably damaging 1.00
IGL00569:Ptpn13 APN 5 103591006 splice site probably benign
IGL00764:Ptpn13 APN 5 103597718 missense probably damaging 1.00
IGL00805:Ptpn13 APN 5 103554729 missense probably benign 0.33
IGL00922:Ptpn13 APN 5 103588088 missense probably damaging 1.00
IGL00959:Ptpn13 APN 5 103517571 critical splice donor site probably null
IGL01090:Ptpn13 APN 5 103541314 missense probably null 0.80
IGL01352:Ptpn13 APN 5 103486775 splice site probably null
IGL01510:Ptpn13 APN 5 103562300 missense probably damaging 1.00
IGL01515:Ptpn13 APN 5 103556113 missense probably benign 0.06
IGL01896:Ptpn13 APN 5 103501523 missense possibly damaging 0.78
IGL02094:Ptpn13 APN 5 103594617 missense probably damaging 1.00
IGL02561:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02562:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02567:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02604:Ptpn13 APN 5 103501903 missense probably benign 0.01
IGL02679:Ptpn13 APN 5 103569454 missense possibly damaging 0.55
IGL02981:Ptpn13 APN 5 103528804 missense probably damaging 1.00
IGL03131:Ptpn13 APN 5 103517559 missense probably benign
IGL03136:Ptpn13 APN 5 103543463 missense possibly damaging 0.49
IGL03163:Ptpn13 APN 5 103591346 missense probably damaging 1.00
IGL03271:Ptpn13 APN 5 103462148 missense probably damaging 1.00
IGL03297:Ptpn13 APN 5 103541077 missense probably benign 0.13
IGL03328:Ptpn13 APN 5 103516348 missense probably benign 0.00
IGL03343:Ptpn13 APN 5 103554950 missense possibly damaging 0.88
IGL02835:Ptpn13 UTSW 5 103560025 missense probably damaging 0.98
P0021:Ptpn13 UTSW 5 103528820 missense probably benign 0.39
R0017:Ptpn13 UTSW 5 103486772 critical splice donor site probably null
R0090:Ptpn13 UTSW 5 103569503 missense probably damaging 1.00
R0111:Ptpn13 UTSW 5 103580763 splice site probably benign
R0183:Ptpn13 UTSW 5 103516408 missense probably benign 0.00
R0230:Ptpn13 UTSW 5 103527131 missense probably damaging 1.00
R0302:Ptpn13 UTSW 5 103565225 missense probably benign
R0360:Ptpn13 UTSW 5 103533348 missense probably damaging 1.00
R0364:Ptpn13 UTSW 5 103533348 missense probably damaging 1.00
R0388:Ptpn13 UTSW 5 103555062 missense probably benign 0.31
R0504:Ptpn13 UTSW 5 103501496 missense possibly damaging 0.92
R0558:Ptpn13 UTSW 5 103529717 missense probably damaging 0.99
R0562:Ptpn13 UTSW 5 103516425 critical splice donor site probably null
R0568:Ptpn13 UTSW 5 103489765 missense probably damaging 1.00
R0609:Ptpn13 UTSW 5 103556145 missense probably benign
R0669:Ptpn13 UTSW 5 103556109 missense probably benign
R0739:Ptpn13 UTSW 5 103575132 missense probably benign
R1006:Ptpn13 UTSW 5 103586789 missense probably benign 0.04
R1164:Ptpn13 UTSW 5 103489773 missense probably damaging 1.00
R1274:Ptpn13 UTSW 5 103550260 missense probably damaging 0.98
R1501:Ptpn13 UTSW 5 103516364 missense probably benign 0.01
R1529:Ptpn13 UTSW 5 103564132 missense probably benign 0.00
R1533:Ptpn13 UTSW 5 103556178 nonsense probably null
R1613:Ptpn13 UTSW 5 103536871 missense possibly damaging 0.89
R1616:Ptpn13 UTSW 5 103565237 missense possibly damaging 0.49
R1830:Ptpn13 UTSW 5 103543459 missense probably benign 0.00
R1892:Ptpn13 UTSW 5 103501679 missense possibly damaging 0.92
R1907:Ptpn13 UTSW 5 103580709 missense probably null 0.45
R2143:Ptpn13 UTSW 5 103556133 missense probably benign
R2145:Ptpn13 UTSW 5 103556133 missense probably benign
R2180:Ptpn13 UTSW 5 103569558 missense probably damaging 1.00
R2264:Ptpn13 UTSW 5 103489661 missense possibly damaging 0.96
R2313:Ptpn13 UTSW 5 103564161 missense probably damaging 1.00
R3522:Ptpn13 UTSW 5 103589854 splice site probably benign
R3773:Ptpn13 UTSW 5 103477121 missense probably damaging 1.00
R3924:Ptpn13 UTSW 5 103550741 splice site probably benign
R4289:Ptpn13 UTSW 5 103533285 missense probably damaging 1.00
R4348:Ptpn13 UTSW 5 103569726 missense probably damaging 1.00
R4385:Ptpn13 UTSW 5 103533407 splice site probably null
R4526:Ptpn13 UTSW 5 103501469 missense probably benign 0.32
R4557:Ptpn13 UTSW 5 103541110 missense probably damaging 1.00
R4596:Ptpn13 UTSW 5 103523692 missense probably benign 0.06
R4632:Ptpn13 UTSW 5 103569860 missense possibly damaging 0.46
R4727:Ptpn13 UTSW 5 103569855 missense probably benign
R4780:Ptpn13 UTSW 5 103586773 missense probably benign 0.04
R4793:Ptpn13 UTSW 5 103582778 critical splice donor site probably null
R4812:Ptpn13 UTSW 5 103523615 missense probably benign 0.00
R4939:Ptpn13 UTSW 5 103517469 intron probably null
R4951:Ptpn13 UTSW 5 103588046 missense probably benign 0.00
R5052:Ptpn13 UTSW 5 103561980 missense probably damaging 1.00
R5148:Ptpn13 UTSW 5 103492232 missense probably damaging 1.00
R5309:Ptpn13 UTSW 5 103541053 missense probably damaging 1.00
R5521:Ptpn13 UTSW 5 103501428 missense probably benign 0.03
R5545:Ptpn13 UTSW 5 103561964 missense probably damaging 1.00
R5696:Ptpn13 UTSW 5 103554759 missense probably benign 0.20
R5735:Ptpn13 UTSW 5 103554820 missense probably benign 0.03
R5815:Ptpn13 UTSW 5 103597690 splice site probably null
R5876:Ptpn13 UTSW 5 103476960 missense probably damaging 1.00
R5878:Ptpn13 UTSW 5 103477118 missense possibly damaging 0.89
R6366:Ptpn13 UTSW 5 103551053 missense probably damaging 1.00
R6455:Ptpn13 UTSW 5 103541284 missense probably benign 0.00
R6492:Ptpn13 UTSW 5 103501612 missense probably benign 0.02
R6709:Ptpn13 UTSW 5 103586756 missense probably benign 0.18
R6759:Ptpn13 UTSW 5 103565255 missense possibly damaging 0.49
R6944:Ptpn13 UTSW 5 103476991 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AAGCATGCTCCACTTCTAAGC -3'
(R):5'- AGGAGCCTTATGTTCACTTTCCG -3'

Sequencing Primer
(F):5'- TTCTAAGCAAAAGCCAGTGTCCTTC -3'
(R):5'- GTTCACTTTCCGCCGCTGG -3'
Posted On2014-10-01