Incidental Mutation 'R2151:Nf1'
ID234285
Institutional Source Beutler Lab
Gene Symbol Nf1
Ensembl Gene ENSMUSG00000020716
Gene Nameneurofibromin 1
SynonymsNf-1, neurofibromin
MMRRC Submission 040154-MU
Accession Numbers

Genbank: NM_010897; MGI: 97306

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2151 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location79339693-79581612 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79447570 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1136 (M1136K)
Ref Sequence ENSEMBL: ENSMUSP00000103886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251] [ENSMUST00000219057]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071325
AA Change: M1136K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716
AA Change: M1136K

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108251
AA Change: M1136K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716
AA Change: M1136K

DomainStartEndE-ValueType
RasGAP 1189 1538 1.23e-153 SMART
SEC14 1564 1716 2.36e-11 SMART
low complexity region 2598 2608 N/A INTRINSIC
low complexity region 2729 2742 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130979
Predicted Effect possibly damaging
Transcript: ENSMUST00000219057
AA Change: M1146K

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.28 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,478,875 V47I possibly damaging Het
4930447C04Rik T C 12: 72,907,951 probably null Het
4930579F01Rik A G 3: 138,176,456 probably null Het
Abhd17c G T 7: 84,151,455 H130Q probably damaging Het
Actr10 T A 12: 70,940,801 C27* probably null Het
AF529169 T G 9: 89,602,168 K392T possibly damaging Het
Als2 G A 1: 59,207,789 H564Y probably damaging Het
Art5 A G 7: 102,098,200 L124P possibly damaging Het
Asap2 A T 12: 21,112,083 T14S probably damaging Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Bicd2 G T 13: 49,379,576 C546F probably damaging Het
Cnbp C T 6: 87,845,299 G81D probably damaging Het
Dnah5 T C 15: 28,444,091 Y4012H probably damaging Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Drc3 A T 11: 60,375,157 E224V probably benign Het
Ehd2 T C 7: 15,952,203 K315E probably damaging Het
Eif6 A T 2: 155,822,890 N225K probably benign Het
Epg5 T C 18: 78,027,302 V2264A probably benign Het
Faf2 T C 13: 54,648,407 F126L probably damaging Het
Fam71b A T 11: 46,405,331 K177* probably null Het
Fiz1 T C 7: 5,012,881 S37G possibly damaging Het
Frs3 T C 17: 47,703,062 S227P probably benign Het
Gm21188 C T 13: 120,034,799 C178Y unknown Het
Gm4787 T A 12: 81,377,219 I722F probably benign Het
Gm6370 T A 5: 146,493,641 L212Q probably damaging Het
Gmnc G A 16: 26,960,706 H142Y possibly damaging Het
Gna15 T C 10: 81,502,904 Y367C probably damaging Het
Gpr158 G A 2: 21,827,514 V1142M possibly damaging Het
Gpx6 A G 13: 21,318,971 K185R probably damaging Het
Hc A C 2: 34,991,103 probably benign Het
Hdac9 A G 12: 34,390,256 S375P probably damaging Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Klre1 G A 6: 129,580,033 E33K possibly damaging Het
Ldhb C A 6: 142,498,670 V86L possibly damaging Het
Magi3 T A 3: 104,046,882 K713I probably damaging Het
Magi3 T C 3: 104,085,238 Y306C probably damaging Het
Mmp17 T C 5: 129,605,661 Y455H probably benign Het
Mmp25 T A 17: 23,631,074 Y504F probably damaging Het
Myo1a T C 10: 127,720,181 I969T probably benign Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nmi T C 2: 51,952,543 E179G probably damaging Het
Nov G A 15: 54,752,458 A340T probably benign Het
Nrros A T 16: 32,143,258 M611K probably benign Het
Nsd1 A T 13: 55,291,236 N1692I probably damaging Het
Nuak1 T C 10: 84,409,645 N112S probably benign Het
Odf2l T C 3: 145,149,024 Y488H possibly damaging Het
Olfr1204 C A 2: 88,852,784 P278H probably damaging Het
Olfr935 T A 9: 38,994,716 T240S probably damaging Het
Olfr948 T A 9: 39,319,117 I166F probably damaging Het
Otop2 A G 11: 115,329,411 D359G possibly damaging Het
Pi4ka A T 16: 17,367,507 F243Y probably benign Het
Pnmal2 T C 7: 16,945,912 C274R probably benign Het
Ppp1r42 A G 1: 10,003,347 V6A probably benign Het
Prrg4 A G 2: 104,839,388 L128S probably damaging Het
Prss33 C T 17: 23,834,843 V87M probably damaging Het
Psen2 A G 1: 180,233,664 V278A probably damaging Het
Ptpn13 C A 5: 103,525,785 T538K probably damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Rbak A C 5: 143,176,502 D35E possibly damaging Het
Rbms1 C A 2: 60,762,048 probably null Het
Rgs7bp T A 13: 104,964,089 N226I probably damaging Het
Rnf182 T A 13: 43,668,423 V150E probably benign Het
Sacs A G 14: 61,209,640 Y3045C probably damaging Het
Scp2 G T 4: 108,063,944 A23E probably benign Het
Sec16a A T 2: 26,413,745 probably benign Het
Slc30a5 A T 13: 100,803,949 H619Q probably damaging Het
Slfn10-ps T A 11: 83,035,685 noncoding transcript Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Slx T A X: 26,534,389 probably benign Het
Spns3 C A 11: 72,545,961 probably benign Het
Stxbp1 T A 2: 32,802,856 I383F probably damaging Het
Taf3 C T 2: 9,951,566 E597K possibly damaging Het
Tbcd A G 11: 121,603,631 Q1006R possibly damaging Het
Tenm4 G T 7: 96,902,847 V2498F probably damaging Het
Tex2 T C 11: 106,567,335 probably benign Het
Tkfc A T 19: 10,599,057 L154Q probably damaging Het
Tmem57 A G 4: 134,811,223 V470A probably benign Het
Tmem62 A G 2: 120,986,862 H257R probably damaging Het
Trpm2 T C 10: 77,932,179 I829V probably benign Het
Ttc38 A G 15: 85,851,601 probably null Het
Ttn A T 2: 76,718,413 Y30135* probably null Het
Ttn A G 2: 76,980,133 V17A probably benign Het
Ubqlnl A T 7: 104,148,683 C536S probably benign Het
Vmn1r230 T A 17: 20,846,801 M84K probably damaging Het
Vmn1r235 G A 17: 21,262,366 V318I probably benign Het
Vmn2r76 T C 7: 86,230,484 I203V probably benign Het
Vmn2r97 A T 17: 18,947,322 R613* probably null Het
Zfp180 A G 7: 24,105,260 H368R probably damaging Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Zfyve27 G T 19: 42,171,731 R62L probably benign Het
Other mutations in Nf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Nf1 APN 11 79395905 missense probably damaging 0.99
IGL00801:Nf1 APN 11 79428700 splice site probably benign
IGL00823:Nf1 APN 11 79565517 missense probably damaging 1.00
IGL00945:Nf1 APN 11 79469803 missense probably damaging 0.99
IGL00960:Nf1 APN 11 79445121 missense probably damaging 1.00
IGL01118:Nf1 APN 11 79546986 missense probably damaging 0.99
IGL01604:Nf1 APN 11 79441709 splice site probably benign
IGL01637:Nf1 APN 11 79547120 missense probably damaging 1.00
IGL01659:Nf1 APN 11 79559449 missense probably benign
IGL01764:Nf1 APN 11 79384187 missense probably benign
IGL01772:Nf1 APN 11 79390249 missense probably damaging 1.00
IGL02047:Nf1 APN 11 79425535 missense probably benign 0.04
IGL02052:Nf1 APN 11 79412727 missense probably damaging 1.00
IGL02071:Nf1 APN 11 79444121 missense possibly damaging 0.96
IGL02312:Nf1 APN 11 79444648 missense possibly damaging 0.95
IGL02341:Nf1 APN 11 79564926 missense probably benign 0.33
IGL02390:Nf1 APN 11 79565935 missense possibly damaging 0.64
IGL02390:Nf1 APN 11 79411676 splice site probably benign
IGL02475:Nf1 APN 11 79535667 missense probably damaging 1.00
IGL02567:Nf1 APN 11 79547143 missense probably damaging 1.00
IGL02571:Nf1 APN 11 79428627 missense probably damaging 1.00
IGL02664:Nf1 APN 11 79444598 critical splice acceptor site probably null
IGL02664:Nf1 APN 11 79444599 critical splice acceptor site probably null
IGL02992:Nf1 APN 11 79434933 splice site probably benign
IGL03006:Nf1 APN 11 79545431 missense probably damaging 1.00
IGL03216:Nf1 APN 11 79564895 missense probably benign 0.17
Franklin UTSW 11 79473320 splice site probably null
Jefferson UTSW 11 79446864 missense probably damaging 1.00
Phyletic_dwarf UTSW 11 79454189 missense probably damaging 1.00
C9142:Nf1 UTSW 11 79556731 missense probably damaging 0.98
I2289:Nf1 UTSW 11 79547776 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0081:Nf1 UTSW 11 79453979 splice site probably benign
R0115:Nf1 UTSW 11 79468876 critical splice donor site probably null
R0144:Nf1 UTSW 11 79547127 missense probably damaging 1.00
R0196:Nf1 UTSW 11 79468769 missense possibly damaging 0.94
R0196:Nf1 UTSW 11 79578272 missense probably damaging 1.00
R0217:Nf1 UTSW 11 79428574 splice site probably benign
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0255:Nf1 UTSW 11 79408699 splice site probably null
R0362:Nf1 UTSW 11 79536878 missense probably damaging 1.00
R0364:Nf1 UTSW 11 79441957 nonsense probably null
R0464:Nf1 UTSW 11 79556789 missense probably benign 0.17
R0511:Nf1 UTSW 11 79438769 missense probably benign 0.01
R0549:Nf1 UTSW 11 79468771 missense probably damaging 0.99
R0585:Nf1 UTSW 11 79568701 missense probably damaging 0.99
R0636:Nf1 UTSW 11 79535703 missense probably damaging 0.99
R0924:Nf1 UTSW 11 79453866 missense probably damaging 0.98
R0942:Nf1 UTSW 11 79438711 missense probably benign 0.00
R1022:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1024:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1350:Nf1 UTSW 11 79412687 missense probably damaging 1.00
R1365:Nf1 UTSW 11 79547885 splice site probably null
R1395:Nf1 UTSW 11 79535983 missense possibly damaging 0.49
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1477:Nf1 UTSW 11 79395859 nonsense probably null
R1508:Nf1 UTSW 11 79440909 missense probably damaging 1.00
R1512:Nf1 UTSW 11 79390369 missense probably damaging 1.00
R1605:Nf1 UTSW 11 79440923 missense probably benign 0.01
R1680:Nf1 UTSW 11 79550998 nonsense probably null
R1704:Nf1 UTSW 11 79463301 splice site probably null
R1707:Nf1 UTSW 11 79535604 missense probably damaging 1.00
R1741:Nf1 UTSW 11 79443931 missense probably benign
R1761:Nf1 UTSW 11 79384265 missense probably damaging 1.00
R1800:Nf1 UTSW 11 79553968 missense possibly damaging 0.94
R1873:Nf1 UTSW 11 79547161 missense probably damaging 1.00
R1966:Nf1 UTSW 11 79411564 missense possibly damaging 0.72
R1967:Nf1 UTSW 11 79412745 missense probably damaging 0.96
R1970:Nf1 UTSW 11 79553961 missense probably benign 0.08
R2059:Nf1 UTSW 11 79556723 missense probably damaging 0.96
R2105:Nf1 UTSW 11 79469826 missense possibly damaging 0.50
R2211:Nf1 UTSW 11 79444064 missense probably benign 0.39
R2497:Nf1 UTSW 11 79443884 missense probably damaging 1.00
R2899:Nf1 UTSW 11 79412758 missense possibly damaging 0.93
R3086:Nf1 UTSW 11 79546986 missense probably damaging 1.00
R3120:Nf1 UTSW 11 79564899 missense probably damaging 0.99
R3744:Nf1 UTSW 11 79548747 missense probably benign 0.23
R3801:Nf1 UTSW 11 79559521 missense probably null 0.98
R3804:Nf1 UTSW 11 79559521 missense probably null 0.98
R4212:Nf1 UTSW 11 79469798 missense probably damaging 1.00
R4298:Nf1 UTSW 11 79384244 missense probably damaging 1.00
R4578:Nf1 UTSW 11 79445759 missense probably damaging 1.00
R4579:Nf1 UTSW 11 79468757 missense probably damaging 1.00
R4587:Nf1 UTSW 11 79536037 critical splice donor site probably null
R4793:Nf1 UTSW 11 79447572 missense probably damaging 1.00
R4834:Nf1 UTSW 11 79546297 missense probably damaging 1.00
R4863:Nf1 UTSW 11 79409409 missense probably damaging 1.00
R4967:Nf1 UTSW 11 79565553 critical splice donor site probably null
R4971:Nf1 UTSW 11 79444643 missense probably damaging 1.00
R5034:Nf1 UTSW 11 79444150 missense probably damaging 0.98
R5036:Nf1 UTSW 11 79446864 missense probably damaging 1.00
R5207:Nf1 UTSW 11 79454189 missense probably damaging 1.00
R5348:Nf1 UTSW 11 79564899 missense probably damaging 1.00
R5356:Nf1 UTSW 11 79473456 missense possibly damaging 0.94
R5444:Nf1 UTSW 11 79443959 missense possibly damaging 0.94
R5533:Nf1 UTSW 11 79445789 missense probably damaging 0.99
R5918:Nf1 UTSW 11 79569222 intron probably benign
R5978:Nf1 UTSW 11 79540419 missense probably damaging 1.00
R6140:Nf1 UTSW 11 79473320 splice site probably null
R6195:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6216:Nf1 UTSW 11 79411607 missense possibly damaging 0.93
R6233:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6257:Nf1 UTSW 11 79549491 missense probably damaging 1.00
R6258:Nf1 UTSW 11 79565755 intron probably null
R6756:Nf1 UTSW 11 79444587 splice site probably null
R6878:Nf1 UTSW 11 79434882 missense probably damaging 1.00
R6959:Nf1 UTSW 11 79549468 missense probably damaging 0.98
X0052:Nf1 UTSW 11 79559416 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGATGCTTACAGTGGCCCAC -3'
(R):5'- GCCTGGCTGAAGCAATTTTC -3'

Sequencing Primer
(F):5'- GTGGCCCACATAATCATTCAGAATGG -3'
(R):5'- CATGTATGCCTGGTTACCACAGAG -3'
Posted On2014-10-01