Incidental Mutation 'R2151:Hdac9'
ID234293
Institutional Source Beutler Lab
Gene Symbol Hdac9
Ensembl Gene ENSMUSG00000004698
Gene Namehistone deacetylase 9
SynonymsHdac7b, HDRP, Mitr, D030072B18Rik
MMRRC Submission 040154-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2151 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location34047580-34917095 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34390256 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 375 (S375P)
Ref Sequence ENSEMBL: ENSMUSP00000147903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110819] [ENSMUST00000209667] [ENSMUST00000209750] [ENSMUST00000209902] [ENSMUST00000209990] [ENSMUST00000210724] [ENSMUST00000211107] [ENSMUST00000211752]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110819
AA Change: S375P

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106443
Gene: ENSMUSG00000004698
AA Change: S375P

DomainStartEndE-ValueType
Pfam:HDAC4_Gln 37 124 5.4e-36 PFAM
low complexity region 260 284 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209667
AA Change: S331P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209750
AA Change: S378P

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209902
AA Change: S375P

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000209990
AA Change: S334P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000210724
AA Change: S375P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211107
AA Change: S347P

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211752
AA Change: S399P

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene has sequence homology to members of the histone deacetylase family. This gene is orthologous to the Xenopus and mouse MITR genes. The MITR protein lacks the histone deacetylase catalytic domain. It represses MEF2 activity through recruitment of multicomponent corepressor complexes that include CtBP and HDACs. This encoded protein may play a role in hematopoiesis. Multiple alternatively spliced transcripts have been described for this gene but the full-length nature of some of them has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display age dependent cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,478,875 V47I possibly damaging Het
4930447C04Rik T C 12: 72,907,951 probably null Het
4930579F01Rik A G 3: 138,176,456 probably null Het
Abhd17c G T 7: 84,151,455 H130Q probably damaging Het
Actr10 T A 12: 70,940,801 C27* probably null Het
AF529169 T G 9: 89,602,168 K392T possibly damaging Het
Als2 G A 1: 59,207,789 H564Y probably damaging Het
Art5 A G 7: 102,098,200 L124P possibly damaging Het
Asap2 A T 12: 21,112,083 T14S probably damaging Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Bicd2 G T 13: 49,379,576 C546F probably damaging Het
Cnbp C T 6: 87,845,299 G81D probably damaging Het
Dnah5 T C 15: 28,444,091 Y4012H probably damaging Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Drc3 A T 11: 60,375,157 E224V probably benign Het
Ehd2 T C 7: 15,952,203 K315E probably damaging Het
Eif6 A T 2: 155,822,890 N225K probably benign Het
Epg5 T C 18: 78,027,302 V2264A probably benign Het
Faf2 T C 13: 54,648,407 F126L probably damaging Het
Fam71b A T 11: 46,405,331 K177* probably null Het
Fiz1 T C 7: 5,012,881 S37G possibly damaging Het
Frs3 T C 17: 47,703,062 S227P probably benign Het
Gm21188 C T 13: 120,034,799 C178Y unknown Het
Gm4787 T A 12: 81,377,219 I722F probably benign Het
Gm6370 T A 5: 146,493,641 L212Q probably damaging Het
Gmnc G A 16: 26,960,706 H142Y possibly damaging Het
Gna15 T C 10: 81,502,904 Y367C probably damaging Het
Gpr158 G A 2: 21,827,514 V1142M possibly damaging Het
Gpx6 A G 13: 21,318,971 K185R probably damaging Het
Hc A C 2: 34,991,103 probably benign Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Klre1 G A 6: 129,580,033 E33K possibly damaging Het
Ldhb C A 6: 142,498,670 V86L possibly damaging Het
Magi3 T A 3: 104,046,882 K713I probably damaging Het
Magi3 T C 3: 104,085,238 Y306C probably damaging Het
Mmp17 T C 5: 129,605,661 Y455H probably benign Het
Mmp25 T A 17: 23,631,074 Y504F probably damaging Het
Myo1a T C 10: 127,720,181 I969T probably benign Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nf1 T A 11: 79,447,570 M1136K possibly damaging Het
Nmi T C 2: 51,952,543 E179G probably damaging Het
Nov G A 15: 54,752,458 A340T probably benign Het
Nrros A T 16: 32,143,258 M611K probably benign Het
Nsd1 A T 13: 55,291,236 N1692I probably damaging Het
Nuak1 T C 10: 84,409,645 N112S probably benign Het
Odf2l T C 3: 145,149,024 Y488H possibly damaging Het
Olfr1204 C A 2: 88,852,784 P278H probably damaging Het
Olfr935 T A 9: 38,994,716 T240S probably damaging Het
Olfr948 T A 9: 39,319,117 I166F probably damaging Het
Otop2 A G 11: 115,329,411 D359G possibly damaging Het
Pi4ka A T 16: 17,367,507 F243Y probably benign Het
Pnmal2 T C 7: 16,945,912 C274R probably benign Het
Ppp1r42 A G 1: 10,003,347 V6A probably benign Het
Prrg4 A G 2: 104,839,388 L128S probably damaging Het
Prss33 C T 17: 23,834,843 V87M probably damaging Het
Psen2 A G 1: 180,233,664 V278A probably damaging Het
Ptpn13 C A 5: 103,525,785 T538K probably damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Rbak A C 5: 143,176,502 D35E possibly damaging Het
Rbms1 C A 2: 60,762,048 probably null Het
Rgs7bp T A 13: 104,964,089 N226I probably damaging Het
Rnf182 T A 13: 43,668,423 V150E probably benign Het
Sacs A G 14: 61,209,640 Y3045C probably damaging Het
Scp2 G T 4: 108,063,944 A23E probably benign Het
Sec16a A T 2: 26,413,745 probably benign Het
Slc30a5 A T 13: 100,803,949 H619Q probably damaging Het
Slfn10-ps T A 11: 83,035,685 noncoding transcript Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Slx T A X: 26,534,389 probably benign Het
Spns3 C A 11: 72,545,961 probably benign Het
Stxbp1 T A 2: 32,802,856 I383F probably damaging Het
Taf3 C T 2: 9,951,566 E597K possibly damaging Het
Tbcd A G 11: 121,603,631 Q1006R possibly damaging Het
Tenm4 G T 7: 96,902,847 V2498F probably damaging Het
Tex2 T C 11: 106,567,335 probably benign Het
Tkfc A T 19: 10,599,057 L154Q probably damaging Het
Tmem57 A G 4: 134,811,223 V470A probably benign Het
Tmem62 A G 2: 120,986,862 H257R probably damaging Het
Trpm2 T C 10: 77,932,179 I829V probably benign Het
Ttc38 A G 15: 85,851,601 probably null Het
Ttn A T 2: 76,718,413 Y30135* probably null Het
Ttn A G 2: 76,980,133 V17A probably benign Het
Ubqlnl A T 7: 104,148,683 C536S probably benign Het
Vmn1r230 T A 17: 20,846,801 M84K probably damaging Het
Vmn1r235 G A 17: 21,262,366 V318I probably benign Het
Vmn2r76 T C 7: 86,230,484 I203V probably benign Het
Vmn2r97 A T 17: 18,947,322 R613* probably null Het
Zfp180 A G 7: 24,105,260 H368R probably damaging Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Zfyve27 G T 19: 42,171,731 R62L probably benign Het
Other mutations in Hdac9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Hdac9 APN 12 34429489 splice site probably benign
IGL01484:Hdac9 APN 12 34437165 missense probably damaging 1.00
IGL02010:Hdac9 APN 12 34431945 missense probably damaging 1.00
IGL02059:Hdac9 APN 12 34431968 missense probably damaging 0.97
IGL02276:Hdac9 APN 12 34431926 missense probably damaging 1.00
IGL02797:Hdac9 APN 12 34393274 splice site probably benign
IGL03202:Hdac9 APN 12 34373951 missense probably damaging 1.00
R0304:Hdac9 UTSW 12 34374111 missense probably damaging 1.00
R0432:Hdac9 UTSW 12 34437222 missense probably damaging 1.00
R0659:Hdac9 UTSW 12 34437222 missense probably damaging 1.00
R1826:Hdac9 UTSW 12 34429492 splice site probably benign
R1879:Hdac9 UTSW 12 34390333 missense probably damaging 0.98
R1942:Hdac9 UTSW 12 34429545 missense probably damaging 1.00
R2113:Hdac9 UTSW 12 34389332 missense probably damaging 1.00
R2216:Hdac9 UTSW 12 34429517 missense probably damaging 1.00
R2224:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R2225:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R2227:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R3500:Hdac9 UTSW 12 34437353 missense probably benign 0.01
R4441:Hdac9 UTSW 12 34389376 missense probably damaging 1.00
R4674:Hdac9 UTSW 12 34373960 missense possibly damaging 0.96
R4694:Hdac9 UTSW 12 34437247 missense probably damaging 1.00
R5033:Hdac9 UTSW 12 34373907 missense probably benign
R5229:Hdac9 UTSW 12 34437164 missense probably damaging 1.00
R5353:Hdac9 UTSW 12 34393393 nonsense probably null
R5384:Hdac9 UTSW 12 34429558 missense probably damaging 1.00
R5958:Hdac9 UTSW 12 34373883 missense probably damaging 0.97
R6129:Hdac9 UTSW 12 34287475 missense probably damaging 1.00
R6157:Hdac9 UTSW 12 34389429 missense probably damaging 1.00
R6248:Hdac9 UTSW 12 34528294 missense possibly damaging 0.79
R6333:Hdac9 UTSW 12 34052324 missense probably damaging 0.98
R6474:Hdac9 UTSW 12 34431991 critical splice acceptor site probably null
R6589:Hdac9 UTSW 12 34215029 missense probably damaging 1.00
R6737:Hdac9 UTSW 12 34215452 missense probably damaging 1.00
R6767:Hdac9 UTSW 12 34287529 missense probably damaging 1.00
R6837:Hdac9 UTSW 12 34287464 missense probably benign 0.12
R6857:Hdac9 UTSW 12 34393363 missense probably benign 0.37
Z1088:Hdac9 UTSW 12 34407789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCACTTGTACAACATCAGG -3'
(R):5'- CAGTGGGCACAAGAAACTTAC -3'

Sequencing Primer
(F):5'- GAGTTAAATGTCACACTGGATCACTG -3'
(R):5'- TTACATAATAACGAGAGCCCTAGC -3'
Posted On2014-10-01