Incidental Mutation 'R0196:P3h3'
ID23432
Institutional Source Beutler Lab
Gene Symbol P3h3
Ensembl Gene ENSMUSG00000023191
Gene Nameprolyl 3-hydroxylase 3
SynonymsGrcb, Leprel2
MMRRC Submission 038455-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0196 (G1)
Quality Score210
Status Not validated
Chromosome6
Chromosomal Location124841089-124857752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124845272 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 583 (N583Y)
Ref Sequence ENSEMBL: ENSMUSP00000023958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023958] [ENSMUST00000024206] [ENSMUST00000135127]
Predicted Effect probably damaging
Transcript: ENSMUST00000023958
AA Change: N583Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023958
Gene: ENSMUSG00000023191
AA Change: N583Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
P4Hc 460 670 8.51e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000024206
SMART Domains Protein: ENSMUSP00000024206
Gene: ENSMUSG00000023439

DomainStartEndE-ValueType
WD40 44 83 4.91e-8 SMART
WD40 86 125 1.61e-3 SMART
WD40 132 170 5.1e-6 SMART
WD40 173 212 3.99e-8 SMART
WD40 215 254 2.67e-9 SMART
WD40 263 298 2e-1 SMART
WD40 301 340 3.87e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129225
Predicted Effect probably benign
Transcript: ENSMUST00000135127
SMART Domains Protein: ENSMUSP00000116338
Gene: ENSMUSG00000023191

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149870
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 81.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the leprecan family of proteoglycans, which function as collagen prolyl hydroxylases that are required for proper collagen biosynthesis, folding and assembly. This protein, like other family members, is thought to reside in the endoplasmic reticulum. Epigenetic inactivation of this gene is associated with breast and other cancers, suggesting that it may function as a tumor suppressor. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit collagen fiber fragility in the skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,616,247 probably benign Het
Aass G A 6: 23,109,520 P317L probably damaging Het
Abca12 T A 1: 71,259,813 N2313I possibly damaging Het
Adamts12 T C 15: 11,071,508 I46T probably benign Het
Adipoq T G 16: 23,146,643 probably null Het
Amy1 A T 3: 113,569,421 D92E probably benign Het
Asb15 G A 6: 24,564,393 R282Q probably damaging Het
Bag6 G C 17: 35,144,263 G693A probably damaging Het
Birc6 T C 17: 74,580,287 I870T possibly damaging Het
Cand2 A G 6: 115,789,502 K356R probably damaging Het
Cbfa2t3 T C 8: 122,633,337 Q525R possibly damaging Het
Ccdc94 C A 17: 55,964,653 D191E probably damaging Het
Cd4 T C 6: 124,867,806 R339G probably damaging Het
Cdh8 A G 8: 99,190,434 S350P probably damaging Het
Cep295 A T 9: 15,338,213 S469T probably damaging Het
Ckap2l A T 2: 129,285,422 S279T probably benign Het
Clnk T A 5: 38,769,939 N66Y probably damaging Het
Col27a1 A T 4: 63,224,266 T64S probably benign Het
Crtc1 T C 8: 70,386,221 D599G probably damaging Het
Cyp2c23 A C 19: 44,012,356 I363S probably damaging Het
Dnah10 A T 5: 124,834,075 I4519F possibly damaging Het
Dner T A 1: 84,370,832 I716F probably damaging Het
Dsel T G 1: 111,861,603 T401P possibly damaging Het
Egfr A G 11: 16,911,746 D1175G probably benign Het
Ephb3 A T 16: 21,218,054 N343I probably damaging Het
Fbxw10 T A 11: 62,877,244 F974I probably benign Het
Gfi1b T C 2: 28,613,774 Y138C probably damaging Het
Gm11168 T A 9: 3,005,175 L6H probably benign Het
Grb10 A C 11: 11,945,583 V247G probably damaging Het
Gstp2 A T 19: 4,040,514 probably null Het
Hars2 C T 18: 36,789,204 Q291* probably null Het
Hyal4 G T 6: 24,756,221 W146L probably damaging Het
Il22ra1 C T 4: 135,734,245 T107I possibly damaging Het
Itga8 A G 2: 12,204,729 probably null Het
Klhl25 T C 7: 75,865,702 S119P probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lrrc8c T C 5: 105,606,770 V137A probably benign Het
Macrod2 A T 2: 142,176,625 E226V probably damaging Het
Mcemp1 A T 8: 3,668,201 Q165L probably benign Het
Mcpt9 T A 14: 56,027,996 K82M probably benign Het
Mpzl3 A G 9: 45,062,160 T66A probably damaging Het
Msh6 G A 17: 87,980,360 V143I possibly damaging Het
Mug1 G A 6: 121,838,725 probably null Het
Ncr1 G T 7: 4,340,973 C153F probably damaging Het
Nf1 T A 11: 79,468,769 M1411K possibly damaging Het
Nf1 T A 11: 79,578,272 V786D probably damaging Het
Nisch T C 14: 31,203,394 probably benign Het
Nwd2 T A 5: 63,806,351 Y1093N probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr392 A T 11: 73,814,905 M59K probably damaging Het
Oxa1l T C 14: 54,363,487 I139T probably damaging Het
Pcdh18 A T 3: 49,756,698 probably null Het
Pcnp C T 16: 56,024,533 probably benign Het
Pdzd8 G T 19: 59,301,131 D612E probably benign Het
Pi4kb T C 3: 94,998,950 S8P probably damaging Het
Pikfyve T G 1: 65,256,072 V1454G possibly damaging Het
Podn T C 4: 108,021,498 N246D probably damaging Het
Prg4 T C 1: 150,454,492 probably benign Het
R3hdm2 T C 10: 127,484,521 Y523H probably damaging Het
Rpf1 T A 3: 146,508,149 E231V possibly damaging Het
Slc16a10 C T 10: 40,056,615 E317K probably benign Het
Slc34a1 A T 13: 55,412,265 I435F probably damaging Het
Snx19 A G 9: 30,433,387 D629G probably damaging Het
Tomm70a T C 16: 57,146,100 I472T probably benign Het
Trp53 A G 11: 69,588,680 Y202C probably damaging Het
Ttc14 T A 3: 33,809,254 probably benign Het
Ugt1a1 C T 1: 88,212,555 A185V possibly damaging Het
Usp28 A G 9: 49,028,278 D655G probably damaging Het
Vmn1r215 C T 13: 23,076,084 T98I probably damaging Het
Vmn2r121 G T X: 124,132,182 T426N probably benign Het
Vmn2r99 A G 17: 19,394,573 N852D probably benign Het
Xrn2 T A 2: 147,047,660 D654E probably damaging Het
Zfp335 C G 2: 164,896,145 A849P possibly damaging Het
Zfp954 C T 7: 7,115,391 V385M probably damaging Het
Zmynd15 A G 11: 70,464,226 T350A probably damaging Het
Other mutations in P3h3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:P3h3 APN 6 124845589 missense probably benign 0.26
IGL02158:P3h3 APN 6 124853092 missense probably damaging 1.00
IGL02654:P3h3 APN 6 124845265 missense possibly damaging 0.95
P0040:P3h3 UTSW 6 124853136 missense probably damaging 0.99
R0024:P3h3 UTSW 6 124857458 missense probably benign
R0328:P3h3 UTSW 6 124854306 unclassified probably benign
R0589:P3h3 UTSW 6 124841681 missense probably damaging 1.00
R0605:P3h3 UTSW 6 124856035 missense probably damaging 1.00
R0793:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0794:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0795:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0796:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0853:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0854:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0856:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0893:P3h3 UTSW 6 124845513 missense probably damaging 1.00
R1819:P3h3 UTSW 6 124854932 missense probably benign 0.05
R2100:P3h3 UTSW 6 124845042 missense probably damaging 1.00
R4332:P3h3 UTSW 6 124842136 missense probably damaging 1.00
R4461:P3h3 UTSW 6 124845568 missense probably benign 0.08
R4533:P3h3 UTSW 6 124854408 missense possibly damaging 0.62
R4829:P3h3 UTSW 6 124841638 utr 3 prime probably benign
R4840:P3h3 UTSW 6 124850637 missense possibly damaging 0.82
R4962:P3h3 UTSW 6 124841773 missense probably benign 0.09
R5014:P3h3 UTSW 6 124855236 missense probably damaging 1.00
R5591:P3h3 UTSW 6 124854695 unclassified probably benign
R5691:P3h3 UTSW 6 124855153 missense probably damaging 1.00
R5777:P3h3 UTSW 6 124855958 missense probably benign 0.24
R5846:P3h3 UTSW 6 124857194 critical splice donor site probably null
R6212:P3h3 UTSW 6 124845643 missense probably benign 0.19
R6254:P3h3 UTSW 6 124845601 missense probably damaging 1.00
R6320:P3h3 UTSW 6 124854872 missense probably benign 0.02
R6860:P3h3 UTSW 6 124857368 missense probably benign 0.01
R7385:P3h3 UTSW 6 124855270 missense probably damaging 1.00
R7472:P3h3 UTSW 6 124850631 missense not run
X0021:P3h3 UTSW 6 124856029 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCGCCTCCCTTGAAGTCATCATTG -3'
(R):5'- TGCCGAAGTGCCATAGAAGGTAAC -3'

Sequencing Primer
(F):5'- CCCTTGAAGTCATCATTGAGGTAGAG -3'
(R):5'- GCAGAAAGTCCCCCACTGG -3'
Posted On2013-04-16