Incidental Mutation 'R2151:Frs3'
ID234321
Institutional Source Beutler Lab
Gene Symbol Frs3
Ensembl Gene ENSMUSG00000023266
Gene Namefibroblast growth factor receptor substrate 3
Synonyms4930417B13Rik, SNT2, Frs2beta
MMRRC Submission 040154-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R2151 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location47689030-47704286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47703062 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 227 (S227P)
Ref Sequence ENSEMBL: ENSMUSP00000108921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113296] [ENSMUST00000156118]
Predicted Effect probably benign
Transcript: ENSMUST00000113296
AA Change: S227P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108921
Gene: ENSMUSG00000023266
AA Change: S227P

DomainStartEndE-ValueType
IRS 17 110 4.31e-33 SMART
PTBI 18 110 1.23e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144979
Predicted Effect probably benign
Transcript: ENSMUST00000156118
Meta Mutation Damage Score 0.1512 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (91/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a substrate for the fibroblast growth factor receptor. The encoded protein is found in the peripheral plasma membrane and links fibroblast growth factor receptor stimulation to activators of Ras. The encoded protein down-regulates extracellular regulated kinase 2 through direct binding. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C T 5: 5,478,875 V47I possibly damaging Het
4930447C04Rik T C 12: 72,907,951 probably null Het
4930579F01Rik A G 3: 138,176,456 probably null Het
Abhd17c G T 7: 84,151,455 H130Q probably damaging Het
Actr10 T A 12: 70,940,801 C27* probably null Het
AF529169 T G 9: 89,602,168 K392T possibly damaging Het
Als2 G A 1: 59,207,789 H564Y probably damaging Het
Art5 A G 7: 102,098,200 L124P possibly damaging Het
Asap2 A T 12: 21,112,083 T14S probably damaging Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Bicd2 G T 13: 49,379,576 C546F probably damaging Het
Cnbp C T 6: 87,845,299 G81D probably damaging Het
Dnah5 T C 15: 28,444,091 Y4012H probably damaging Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Drc3 A T 11: 60,375,157 E224V probably benign Het
Ehd2 T C 7: 15,952,203 K315E probably damaging Het
Eif6 A T 2: 155,822,890 N225K probably benign Het
Epg5 T C 18: 78,027,302 V2264A probably benign Het
Faf2 T C 13: 54,648,407 F126L probably damaging Het
Fam71b A T 11: 46,405,331 K177* probably null Het
Fiz1 T C 7: 5,012,881 S37G possibly damaging Het
Gm21188 C T 13: 120,034,799 C178Y unknown Het
Gm4787 T A 12: 81,377,219 I722F probably benign Het
Gm6370 T A 5: 146,493,641 L212Q probably damaging Het
Gmnc G A 16: 26,960,706 H142Y possibly damaging Het
Gna15 T C 10: 81,502,904 Y367C probably damaging Het
Gpr158 G A 2: 21,827,514 V1142M possibly damaging Het
Gpx6 A G 13: 21,318,971 K185R probably damaging Het
Hc A C 2: 34,991,103 probably benign Het
Hdac9 A G 12: 34,390,256 S375P probably damaging Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Klre1 G A 6: 129,580,033 E33K possibly damaging Het
Ldhb C A 6: 142,498,670 V86L possibly damaging Het
Magi3 T A 3: 104,046,882 K713I probably damaging Het
Magi3 T C 3: 104,085,238 Y306C probably damaging Het
Mmp17 T C 5: 129,605,661 Y455H probably benign Het
Mmp25 T A 17: 23,631,074 Y504F probably damaging Het
Myo1a T C 10: 127,720,181 I969T probably benign Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nf1 T A 11: 79,447,570 M1136K possibly damaging Het
Nmi T C 2: 51,952,543 E179G probably damaging Het
Nov G A 15: 54,752,458 A340T probably benign Het
Nrros A T 16: 32,143,258 M611K probably benign Het
Nsd1 A T 13: 55,291,236 N1692I probably damaging Het
Nuak1 T C 10: 84,409,645 N112S probably benign Het
Odf2l T C 3: 145,149,024 Y488H possibly damaging Het
Olfr1204 C A 2: 88,852,784 P278H probably damaging Het
Olfr935 T A 9: 38,994,716 T240S probably damaging Het
Olfr948 T A 9: 39,319,117 I166F probably damaging Het
Otop2 A G 11: 115,329,411 D359G possibly damaging Het
Pi4ka A T 16: 17,367,507 F243Y probably benign Het
Pnmal2 T C 7: 16,945,912 C274R probably benign Het
Ppp1r42 A G 1: 10,003,347 V6A probably benign Het
Prrg4 A G 2: 104,839,388 L128S probably damaging Het
Prss33 C T 17: 23,834,843 V87M probably damaging Het
Psen2 A G 1: 180,233,664 V278A probably damaging Het
Ptpn13 C A 5: 103,525,785 T538K probably damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Rbak A C 5: 143,176,502 D35E possibly damaging Het
Rbms1 C A 2: 60,762,048 probably null Het
Rgs7bp T A 13: 104,964,089 N226I probably damaging Het
Rnf182 T A 13: 43,668,423 V150E probably benign Het
Sacs A G 14: 61,209,640 Y3045C probably damaging Het
Scp2 G T 4: 108,063,944 A23E probably benign Het
Sec16a A T 2: 26,413,745 probably benign Het
Slc30a5 A T 13: 100,803,949 H619Q probably damaging Het
Slfn10-ps T A 11: 83,035,685 noncoding transcript Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Slx T A X: 26,534,389 probably benign Het
Spns3 C A 11: 72,545,961 probably benign Het
Stxbp1 T A 2: 32,802,856 I383F probably damaging Het
Taf3 C T 2: 9,951,566 E597K possibly damaging Het
Tbcd A G 11: 121,603,631 Q1006R possibly damaging Het
Tenm4 G T 7: 96,902,847 V2498F probably damaging Het
Tex2 T C 11: 106,567,335 probably benign Het
Tkfc A T 19: 10,599,057 L154Q probably damaging Het
Tmem57 A G 4: 134,811,223 V470A probably benign Het
Tmem62 A G 2: 120,986,862 H257R probably damaging Het
Trpm2 T C 10: 77,932,179 I829V probably benign Het
Ttc38 A G 15: 85,851,601 probably null Het
Ttn A T 2: 76,718,413 Y30135* probably null Het
Ttn A G 2: 76,980,133 V17A probably benign Het
Ubqlnl A T 7: 104,148,683 C536S probably benign Het
Vmn1r230 T A 17: 20,846,801 M84K probably damaging Het
Vmn1r235 G A 17: 21,262,366 V318I probably benign Het
Vmn2r76 T C 7: 86,230,484 I203V probably benign Het
Vmn2r97 A T 17: 18,947,322 R613* probably null Het
Zfp180 A G 7: 24,105,260 H368R probably damaging Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Zfyve27 G T 19: 42,171,731 R62L probably benign Het
Other mutations in Frs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0310:Frs3 UTSW 17 47703822 missense probably benign
R0575:Frs3 UTSW 17 47703723 missense possibly damaging 0.89
R0638:Frs3 UTSW 17 47701656 missense probably benign 0.00
R1519:Frs3 UTSW 17 47702978 missense probably benign
R1668:Frs3 UTSW 17 47703222 missense possibly damaging 0.94
R2517:Frs3 UTSW 17 47703072 missense probably benign 0.10
R3548:Frs3 UTSW 17 47703636 missense probably damaging 1.00
R3789:Frs3 UTSW 17 47699696 critical splice donor site probably null
R3890:Frs3 UTSW 17 47703435 missense probably damaging 0.99
R4981:Frs3 UTSW 17 47689262 unclassified probably null
R4996:Frs3 UTSW 17 47701710 missense probably damaging 1.00
R5479:Frs3 UTSW 17 47701710 missense probably damaging 1.00
R5944:Frs3 UTSW 17 47692308 intron probably benign
R5990:Frs3 UTSW 17 47701677 missense possibly damaging 0.81
R6102:Frs3 UTSW 17 47702671 missense probably damaging 1.00
R6151:Frs3 UTSW 17 47689088 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GGAGAAACTCTGGCTCTTTTCC -3'
(R):5'- GTTCTCATAGTGCAGCAGGG -3'

Sequencing Primer
(F):5'- GAAACTCTGGCTCTTTTCCTGTCTTC -3'
(R):5'- TCAGGGCTCAGTCTCCAG -3'
Posted On2014-10-01