Incidental Mutation 'R2152:Fat4'
ID234350
Institutional Source Beutler Lab
Gene Symbol Fat4
Ensembl Gene ENSMUSG00000046743
Gene NameFAT atypical cadherin 4
Synonyms6030410K14Rik
MMRRC Submission 040155-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2152 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location38886940-39011985 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38983395 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 3732 (Y3732F)
Ref Sequence ENSEMBL: ENSMUSP00000061836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061260]
Predicted Effect probably damaging
Transcript: ENSMUST00000061260
AA Change: Y3732F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061836
Gene: ENSMUSG00000046743
AA Change: Y3732F

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
CA 60 133 4.09e-7 SMART
CA 157 248 4.51e-18 SMART
CA 272 351 7.66e-30 SMART
CA 380 473 2.55e-17 SMART
CA 497 580 8.27e-26 SMART
CA 605 687 6.46e-28 SMART
CA 711 791 1e-24 SMART
CA 815 891 3.78e-20 SMART
CA 915 994 8.6e-24 SMART
CA 1018 1098 7.09e-25 SMART
CA 1122 1208 6.78e-22 SMART
CA 1232 1313 2.63e-28 SMART
CA 1337 1418 7.25e-31 SMART
CA 1442 1527 4.58e-19 SMART
CA 1550 1629 4.52e-9 SMART
CA 1651 1738 1.3e-9 SMART
CA 1762 1839 2.01e-24 SMART
CA 1863 1942 3.11e-21 SMART
CA 1966 2049 5.85e-26 SMART
CA 2072 2152 1.88e-29 SMART
CA 2176 2257 3.06e-29 SMART
CA 2282 2362 2.61e-23 SMART
CA 2386 2466 2.99e-32 SMART
CA 2490 2568 9.92e-6 SMART
CA 2588 2669 6.58e-20 SMART
CA 2692 2773 7.25e-31 SMART
CA 2796 2872 1.69e-22 SMART
CA 2896 2983 3.16e-22 SMART
CA 3007 3089 1.01e-15 SMART
CA 3113 3194 1.25e-25 SMART
CA 3218 3298 7e-15 SMART
CA 3322 3405 3.96e-14 SMART
CA 3428 3510 3.41e-27 SMART
CA 3532 3614 5.64e-19 SMART
EGF 3807 3862 1.78e-2 SMART
EGF_CA 3864 3900 2.36e-16 SMART
EGF_CA 3902 3938 7.99e-14 SMART
EGF 3943 3976 1.24e-1 SMART
LamG 3996 4144 4.08e-19 SMART
EGF 4167 4200 5.88e-3 SMART
LamG 4244 4375 1.76e-23 SMART
EGF 4430 4464 1.41e-5 SMART
low complexity region 4514 4526 N/A INTRINSIC
low complexity region 4533 4550 N/A INTRINSIC
low complexity region 4840 4849 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protocadherin family. This gene may play a role in regulating planar cell polarity (PCP). Studies in mice suggest that loss of PCP signaling may cause cystic kidney disease, and mutations in this gene have been associated with Van Maldergem Syndrome 2. Alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous inactivation of this gene leads to neonatal lethality, reduced birth body size, curly tails, kyphosis, small lungs, renal cysts, and defects in sternum and vertebrae morphology, neural tube width, cochlear elongation, stereocilia orientation, kidney development, and intestinal elongation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,066,934 D298V probably damaging Het
Ackr3 A T 1: 90,213,843 Y8F probably benign Het
Acy1 T C 9: 106,435,617 E175G probably damaging Het
Add2 T C 6: 86,098,598 L243P probably damaging Het
Adsl A G 15: 80,967,662 D407G probably damaging Het
Afg3l1 T G 8: 123,494,836 I478S probably damaging Het
Arfrp1 T C 2: 181,359,694 T108A probably benign Het
Art5 A G 7: 102,098,200 L124P possibly damaging Het
Asap2 A T 12: 21,112,083 T14S probably damaging Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Bbs12 G T 3: 37,321,160 E586* probably null Het
Bicd2 G T 13: 49,379,576 C546F probably damaging Het
Bid A T 6: 120,900,254 L42Q probably damaging Het
Bpifb9a A G 2: 154,260,135 K51E probably benign Het
Calcr G T 6: 3,687,615 T424K probably benign Het
Cd46 A G 1: 195,062,413 I339T probably benign Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cntn3 A G 6: 102,206,537 I719T probably damaging Het
Cyb5r1 T C 1: 134,409,625 I163T possibly damaging Het
Cyp2d26 A T 15: 82,792,706 probably null Het
Dclk1 A G 3: 55,247,212 Y21C probably damaging Het
Dgcr2 G A 16: 17,891,487 probably null Het
Dhx38 T C 8: 109,560,674 S221G probably benign Het
Dis3l T A 9: 64,307,263 N981I probably benign Het
Dnah3 C T 7: 119,952,013 V3028I probably benign Het
Dnah6 T C 6: 73,049,166 Y3448C probably benign Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Doxl2 T A 6: 48,976,539 I466N probably damaging Het
Epb41l1 A G 2: 156,514,128 D528G probably damaging Het
Fgfr4 A T 13: 55,166,964 Y640F probably damaging Het
Foxo6 T A 4: 120,268,614 D328V probably benign Het
Foxp1 A G 6: 99,016,541 L134P probably damaging Het
Frem2 G A 3: 53,517,029 R2996* probably null Het
Fuk T A 8: 110,889,072 T542S probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gcn1l1 T A 5: 115,609,829 I1765N probably benign Het
Gm4787 T A 12: 81,377,219 I722F probably benign Het
Gpc6 G T 14: 116,926,092 A53S probably benign Het
Gtpbp8 A G 16: 44,740,027 probably null Het
H2-Q2 T C 17: 35,345,276 probably null Het
Hapln2 C A 3: 88,023,613 R157L probably benign Het
Hemgn C A 4: 46,396,607 E210* probably null Het
Hpse T A 5: 100,691,403 K360* probably null Het
Iqcj A T 3: 68,055,310 E68V probably damaging Het
Kat2a T C 11: 100,712,346 probably benign Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Kcnab1 A T 3: 65,371,440 I371F probably damaging Het
Klhl30 C A 1: 91,357,824 A356D probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Mgea5 A T 19: 45,758,022 Y779* probably null Het
Micu1 G T 10: 59,863,288 M468I probably benign Het
Mrc1 A G 2: 14,327,864 T1292A probably damaging Het
Myh8 G A 11: 67,294,469 E849K probably damaging Het
Myom3 G T 4: 135,803,233 R1152L probably benign Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nlrp4g T A 9: 124,353,339 noncoding transcript Het
Olfr1339 C T 4: 118,735,249 A240V possibly damaging Het
Olfr1413 T C 1: 92,573,908 S246P probably damaging Het
Olfr24 T C 9: 18,755,095 D180G probably damaging Het
Olfr33 G T 7: 102,713,581 H277Q probably benign Het
Olfr435 A G 6: 43,202,069 I142V probably benign Het
Olfr592 A T 7: 103,186,640 D13V probably benign Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Olfr969 A T 9: 39,795,647 I91F probably benign Het
Otop1 T A 5: 38,302,851 M587K probably damaging Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phc2 A G 4: 128,745,066 *41W probably null Het
Piezo2 A T 18: 63,114,041 M532K probably damaging Het
Pjvk A T 2: 76,658,369 I295F probably benign Het
Popdc2 A G 16: 38,363,120 N155S possibly damaging Het
Ppp4r3a G T 12: 101,042,567 N684K probably damaging Het
Prpf4b T A 13: 34,900,419 M930K probably benign Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Ptprz1 C A 6: 23,030,671 L1010I probably damaging Het
Rabepk A T 2: 34,784,550 D232E possibly damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Rb1 T C 14: 73,288,725 T169A probably benign Het
Rcc2 T C 4: 140,717,117 L373P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rrbp1 A G 2: 143,954,198 L1200P possibly damaging Het
Sdk1 A G 5: 141,792,944 N226D probably damaging Het
Selenbp1 G A 3: 94,944,130 R398H probably damaging Het
Selenoo A G 15: 89,099,282 M509V probably benign Het
Sidt2 T C 9: 45,945,340 D477G probably damaging Het
Slc2a5 T G 4: 150,125,638 S27A probably damaging Het
Slc30a5 A T 13: 100,803,949 H619Q probably damaging Het
Slc5a9 A G 4: 111,893,223 I146T possibly damaging Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Snx29 A G 16: 11,400,843 D181G possibly damaging Het
Spata31d1c G A 13: 65,033,965 probably null Het
Stat5a C A 11: 100,874,090 T213N probably benign Het
Stt3a A T 9: 36,747,996 V349D probably damaging Het
Tcf20 A T 15: 82,855,602 D549E probably damaging Het
Thbs2 T A 17: 14,673,209 D903V probably damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tmc1 A T 19: 20,856,675 N241K probably benign Het
Tmem260 G T 14: 48,477,609 R240L possibly damaging Het
Tnfaip6 A T 2: 52,043,730 E32D probably damaging Het
Trpa1 A T 1: 14,899,401 H381Q probably damaging Het
Tsen2 T C 6: 115,547,975 I45T possibly damaging Het
Ttc6 G A 12: 57,705,552 V1415I probably damaging Het
Ttll7 G T 3: 146,930,189 R426L probably damaging Het
Ttn A C 2: 76,740,138 S26804A probably damaging Het
Ubqlnl A T 7: 104,148,683 C536S probably benign Het
Vmn2r73 A G 7: 85,857,728 V792A probably benign Het
Zfp345 T C 2: 150,472,658 T320A probably benign Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Other mutations in Fat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Fat4 APN 3 38982249 missense probably damaging 1.00
IGL00509:Fat4 APN 3 38889039 missense probably damaging 1.00
IGL00698:Fat4 APN 3 38981145 missense probably benign 0.17
IGL00934:Fat4 APN 3 38890673 missense probably damaging 1.00
IGL01063:Fat4 APN 3 38890579 missense possibly damaging 0.80
IGL01123:Fat4 APN 3 38957269 missense probably benign 0.00
IGL01313:Fat4 APN 3 39007201 missense possibly damaging 0.53
IGL01328:Fat4 APN 3 38980658 missense probably damaging 1.00
IGL01328:Fat4 APN 3 38889991 missense probably damaging 1.00
IGL01374:Fat4 APN 3 38887498 missense probably damaging 1.00
IGL01412:Fat4 APN 3 38891181 missense probably benign 0.09
IGL01472:Fat4 APN 3 38888070 missense probably damaging 1.00
IGL01514:Fat4 APN 3 38949534 missense possibly damaging 0.89
IGL01548:Fat4 APN 3 39009257 missense probably damaging 1.00
IGL01548:Fat4 APN 3 38887758 missense probably damaging 0.99
IGL01576:Fat4 APN 3 38888947 missense probably damaging 1.00
IGL01591:Fat4 APN 3 39010375 nonsense probably null
IGL01626:Fat4 APN 3 38951032 missense probably damaging 1.00
IGL01746:Fat4 APN 3 38991731 nonsense probably null
IGL01800:Fat4 APN 3 38981729 missense probably damaging 0.99
IGL01815:Fat4 APN 3 38888773 missense probably damaging 1.00
IGL01863:Fat4 APN 3 38970619 splice site probably benign
IGL01917:Fat4 APN 3 38889730 missense possibly damaging 0.89
IGL01936:Fat4 APN 3 38979774 missense probably benign 0.10
IGL02060:Fat4 APN 3 39010271 missense probably damaging 1.00
IGL02103:Fat4 APN 3 38889199 missense probably damaging 0.97
IGL02119:Fat4 APN 3 38982939 missense probably benign 0.10
IGL02124:Fat4 APN 3 38888404 missense probably damaging 1.00
IGL02164:Fat4 APN 3 38996205 critical splice donor site probably null
IGL02182:Fat4 APN 3 38890546 missense probably damaging 1.00
IGL02207:Fat4 APN 3 38951263 missense probably benign 0.16
IGL02210:Fat4 APN 3 38891853 missense probably benign 0.01
IGL02257:Fat4 APN 3 39001139 missense probably benign 0.09
IGL02271:Fat4 APN 3 38979919 missense probably benign 0.18
IGL02305:Fat4 APN 3 39009988 missense probably damaging 1.00
IGL02314:Fat4 APN 3 38887630 missense probably damaging 1.00
IGL02455:Fat4 APN 3 38951131 missense possibly damaging 0.48
IGL02468:Fat4 APN 3 38983046 missense probably benign
IGL02478:Fat4 APN 3 38888215 missense probably damaging 1.00
IGL02480:Fat4 APN 3 39010430 missense probably damaging 1.00
IGL02487:Fat4 APN 3 38887245 missense probably damaging 1.00
IGL02632:Fat4 APN 3 39002764 missense probably benign 0.04
IGL02665:Fat4 APN 3 39002836 missense probably benign 0.08
IGL02674:Fat4 APN 3 38983337 missense probably benign 0.35
IGL02692:Fat4 APN 3 38951086 missense probably damaging 1.00
IGL02710:Fat4 APN 3 38890595 missense probably damaging 1.00
IGL02803:Fat4 APN 3 38889295 missense probably damaging 1.00
IGL02834:Fat4 APN 3 38956744 missense probably damaging 1.00
IGL02891:Fat4 APN 3 38951273 missense probably damaging 1.00
IGL02982:Fat4 APN 3 38890843 missense probably damaging 1.00
IGL02993:Fat4 APN 3 38957155 missense probably damaging 1.00
IGL02996:Fat4 APN 3 38958525 missense probably damaging 1.00
IGL03029:Fat4 APN 3 38982591 missense possibly damaging 0.46
IGL03124:Fat4 APN 3 38981552 missense possibly damaging 0.61
IGL03144:Fat4 APN 3 38956859 missense possibly damaging 0.68
IGL03149:Fat4 APN 3 38991685 missense probably damaging 1.00
IGL03169:Fat4 APN 3 38957398 missense probably benign 0.02
IGL03190:Fat4 APN 3 38981241 missense probably damaging 1.00
IGL03272:Fat4 APN 3 39009703 missense probably benign
IGL03371:Fat4 APN 3 38983187 missense possibly damaging 0.65
IGL03372:Fat4 APN 3 38889134 missense possibly damaging 0.88
IGL03388:Fat4 APN 3 38957227 missense probably damaging 1.00
IGL03394:Fat4 APN 3 38892019 missense probably damaging 0.99
IGL03394:Fat4 APN 3 39009364 missense probably damaging 1.00
IGL03405:Fat4 APN 3 38958450 missense probably benign 0.02
IGL03410:Fat4 APN 3 38891176 missense probably damaging 1.00
expulsion UTSW 3 38889649 missense probably benign 0.00
heineken UTSW 3 38980380 missense probably damaging 1.00
R0015:Fat4 UTSW 3 38982503 missense probably damaging 1.00
R0015:Fat4 UTSW 3 38982503 missense probably damaging 1.00
R0078:Fat4 UTSW 3 38888931 missense probably benign 0.35
R0100:Fat4 UTSW 3 38980248 missense probably damaging 1.00
R0100:Fat4 UTSW 3 38980248 missense probably damaging 1.00
R0201:Fat4 UTSW 3 38891596 missense probably damaging 0.99
R0280:Fat4 UTSW 3 38890816 missense probably benign
R0357:Fat4 UTSW 3 38891227 missense probably damaging 1.00
R0409:Fat4 UTSW 3 38977413 missense probably damaging 1.00
R0498:Fat4 UTSW 3 38980637 missense probably benign 0.00
R0502:Fat4 UTSW 3 39002924 missense probably damaging 0.98
R0506:Fat4 UTSW 3 38888314 missense probably benign 0.00
R0532:Fat4 UTSW 3 38981721 missense probably benign 0.02
R0616:Fat4 UTSW 3 38942870 missense probably damaging 1.00
R0630:Fat4 UTSW 3 39000172 missense probably damaging 1.00
R0678:Fat4 UTSW 3 38889694 missense probably damaging 1.00
R0685:Fat4 UTSW 3 39001178 missense probably benign
R0729:Fat4 UTSW 3 39000295 splice site probably benign
R0748:Fat4 UTSW 3 38887828 missense possibly damaging 0.67
R0811:Fat4 UTSW 3 38957474 missense probably damaging 1.00
R0812:Fat4 UTSW 3 38957474 missense probably damaging 1.00
R0830:Fat4 UTSW 3 38999109 missense probably benign 0.26
R0841:Fat4 UTSW 3 38995998 missense probably damaging 0.99
R0884:Fat4 UTSW 3 38982858 missense possibly damaging 0.89
R1056:Fat4 UTSW 3 38891392 missense probably damaging 1.00
R1066:Fat4 UTSW 3 38957227 missense probably damaging 1.00
R1078:Fat4 UTSW 3 38983086 missense probably benign 0.10
R1084:Fat4 UTSW 3 38979825 missense possibly damaging 0.88
R1118:Fat4 UTSW 3 38982942 missense possibly damaging 0.88
R1213:Fat4 UTSW 3 38890371 missense probably benign 0.01
R1418:Fat4 UTSW 3 38890813 missense probably damaging 1.00
R1475:Fat4 UTSW 3 38888323 missense probably damaging 1.00
R1487:Fat4 UTSW 3 38995917 missense possibly damaging 0.77
R1511:Fat4 UTSW 3 38983076 missense probably damaging 0.97
R1534:Fat4 UTSW 3 38890089 missense probably damaging 1.00
R1558:Fat4 UTSW 3 38888986 missense probably damaging 1.00
R1586:Fat4 UTSW 3 38888860 missense probably damaging 1.00
R1592:Fat4 UTSW 3 39007177 missense probably damaging 0.99
R1655:Fat4 UTSW 3 38957318 missense probably damaging 0.97
R1662:Fat4 UTSW 3 38980779 missense probably damaging 1.00
R1710:Fat4 UTSW 3 38951155 missense probably damaging 1.00
R1731:Fat4 UTSW 3 38891310 missense probably damaging 1.00
R1761:Fat4 UTSW 3 38887489 missense possibly damaging 0.61
R1770:Fat4 UTSW 3 39010268 missense probably damaging 1.00
R1828:Fat4 UTSW 3 38983458 missense probably damaging 1.00
R1835:Fat4 UTSW 3 38983571 missense probably benign 0.00
R1846:Fat4 UTSW 3 38982383 missense probably benign 0.00
R1861:Fat4 UTSW 3 39010484 missense probably benign 0.09
R1871:Fat4 UTSW 3 38981072 missense possibly damaging 0.63
R1981:Fat4 UTSW 3 38991664 missense probably damaging 1.00
R1988:Fat4 UTSW 3 38887115 missense probably benign
R1988:Fat4 UTSW 3 38996090 missense probably damaging 1.00
R2056:Fat4 UTSW 3 38891170 missense possibly damaging 0.88
R2058:Fat4 UTSW 3 38891170 missense possibly damaging 0.88
R2059:Fat4 UTSW 3 38891170 missense possibly damaging 0.88
R2070:Fat4 UTSW 3 39010655 missense probably benign 0.00
R2078:Fat4 UTSW 3 38889673 missense probably damaging 1.00
R2114:Fat4 UTSW 3 38981484 missense probably benign 0.01
R2135:Fat4 UTSW 3 38980733 missense probably damaging 0.98
R2153:Fat4 UTSW 3 38983395 missense probably damaging 1.00
R2154:Fat4 UTSW 3 38887539 missense probably damaging 1.00
R2196:Fat4 UTSW 3 38981417 missense probably benign 0.23
R2211:Fat4 UTSW 3 38891527 missense possibly damaging 0.77
R2219:Fat4 UTSW 3 39010215 missense probably damaging 1.00
R2247:Fat4 UTSW 3 38892049 missense probably damaging 1.00
R2263:Fat4 UTSW 3 38888989 missense possibly damaging 0.93
R2264:Fat4 UTSW 3 38890422 missense probably benign 0.25
R2274:Fat4 UTSW 3 38995899 missense possibly damaging 0.47
R2337:Fat4 UTSW 3 38980011 missense probably damaging 1.00
R2343:Fat4 UTSW 3 38957105 missense probably damaging 0.97
R2365:Fat4 UTSW 3 38980419 missense probably benign
R2412:Fat4 UTSW 3 38957072 missense probably benign 0.05
R2883:Fat4 UTSW 3 38980804 missense probably damaging 1.00
R2942:Fat4 UTSW 3 38982336 missense probably damaging 1.00
R2989:Fat4 UTSW 3 39007153 missense probably benign
R3103:Fat4 UTSW 3 38891940 missense probably benign 0.03
R3158:Fat4 UTSW 3 38890791 missense possibly damaging 0.87
R3800:Fat4 UTSW 3 38981274 missense possibly damaging 0.48
R3808:Fat4 UTSW 3 38982438 missense possibly damaging 0.52
R3848:Fat4 UTSW 3 39007261 missense probably benign 0.10
R3850:Fat4 UTSW 3 39007261 missense probably benign 0.10
R3957:Fat4 UTSW 3 38982346 missense probably benign
R4065:Fat4 UTSW 3 39009197 missense probably benign 0.13
R4078:Fat4 UTSW 3 38980020 missense probably damaging 1.00
R4096:Fat4 UTSW 3 38887875 missense possibly damaging 0.46
R4161:Fat4 UTSW 3 38942809 missense possibly damaging 0.95
R4273:Fat4 UTSW 3 38891627 missense probably damaging 1.00
R4285:Fat4 UTSW 3 38889171 missense probably benign 0.00
R4288:Fat4 UTSW 3 38891763 missense probably damaging 1.00
R4407:Fat4 UTSW 3 38958540 missense probably benign 0.05
R4528:Fat4 UTSW 3 38891294 missense probably benign 0.01
R4547:Fat4 UTSW 3 38951283 missense probably damaging 1.00
R4681:Fat4 UTSW 3 38887342 missense probably damaging 1.00
R4826:Fat4 UTSW 3 38982957 missense probably damaging 1.00
R4855:Fat4 UTSW 3 38888317 missense probably benign
R4871:Fat4 UTSW 3 38891605 missense probably damaging 1.00
R4897:Fat4 UTSW 3 38980632 missense probably damaging 1.00
R4928:Fat4 UTSW 3 39010465 missense probably damaging 1.00
R4932:Fat4 UTSW 3 39007203 missense probably benign 0.00
R4941:Fat4 UTSW 3 38957452 missense probably damaging 1.00
R4943:Fat4 UTSW 3 38980173 missense probably benign 0.19
R4959:Fat4 UTSW 3 38983046 missense probably benign 0.00
R4973:Fat4 UTSW 3 38983046 missense probably benign 0.00
R5098:Fat4 UTSW 3 38888289 missense probably benign 0.34
R5163:Fat4 UTSW 3 38980797 missense probably damaging 1.00
R5213:Fat4 UTSW 3 38980191 missense possibly damaging 0.56
R5328:Fat4 UTSW 3 38956868 missense probably damaging 1.00
R5337:Fat4 UTSW 3 38891627 missense probably damaging 1.00
R5337:Fat4 UTSW 3 39010378 missense probably benign 0.44
R5363:Fat4 UTSW 3 38888005 missense probably damaging 1.00
R5380:Fat4 UTSW 3 38888864 missense probably damaging 1.00
R5384:Fat4 UTSW 3 38995946 missense possibly damaging 0.87
R5422:Fat4 UTSW 3 38887245 missense possibly damaging 0.92
R5436:Fat4 UTSW 3 38891346 missense probably benign 0.00
R5443:Fat4 UTSW 3 39010370 missense probably damaging 1.00
R5501:Fat4 UTSW 3 38887215 missense probably benign 0.09
R5571:Fat4 UTSW 3 39010274 missense probably damaging 1.00
R5625:Fat4 UTSW 3 38888934 missense possibly damaging 0.78
R5652:Fat4 UTSW 3 39002968 missense probably damaging 0.99
R5725:Fat4 UTSW 3 38889625 missense probably damaging 1.00
R5735:Fat4 UTSW 3 38949576 missense probably damaging 1.00
R5739:Fat4 UTSW 3 38983134 missense probably benign 0.01
R5766:Fat4 UTSW 3 38889468 missense probably damaging 1.00
R5780:Fat4 UTSW 3 38980955 missense probably damaging 0.96
R5811:Fat4 UTSW 3 38891787 missense probably damaging 1.00
R5829:Fat4 UTSW 3 39007305 missense probably damaging 1.00
R5879:Fat4 UTSW 3 38887336 missense probably benign
R5933:Fat4 UTSW 3 38951375 critical splice donor site probably null
R5938:Fat4 UTSW 3 38951239 missense probably damaging 1.00
R5940:Fat4 UTSW 3 38889649 missense probably benign 0.00
R5945:Fat4 UTSW 3 38983206 missense probably benign 0.19
R5963:Fat4 UTSW 3 39010547 missense probably damaging 1.00
R6077:Fat4 UTSW 3 39002802 missense probably damaging 1.00
R6158:Fat4 UTSW 3 38983262 missense possibly damaging 0.95
R6246:Fat4 UTSW 3 38891721 missense probably damaging 1.00
R6253:Fat4 UTSW 3 38951356 missense probably damaging 0.99
R6259:Fat4 UTSW 3 39007246 missense probably benign 0.18
R6295:Fat4 UTSW 3 39007080 splice site probably null
R6387:Fat4 UTSW 3 38983785 missense probably damaging 1.00
R6390:Fat4 UTSW 3 38980380 missense probably damaging 1.00
R6456:Fat4 UTSW 3 38983979 missense possibly damaging 0.90
R6493:Fat4 UTSW 3 38890887 missense probably damaging 1.00
R6500:Fat4 UTSW 3 38981269 nonsense probably null
R6503:Fat4 UTSW 3 38982257 missense probably benign 0.00
R6519:Fat4 UTSW 3 39002871 missense probably benign
R6566:Fat4 UTSW 3 38957126 missense possibly damaging 0.78
R6576:Fat4 UTSW 3 38979690 missense probably benign
R6593:Fat4 UTSW 3 38983539 missense probably damaging 1.00
R6658:Fat4 UTSW 3 38942928 missense probably benign 0.01
R6662:Fat4 UTSW 3 38956821 missense possibly damaging 0.95
R6690:Fat4 UTSW 3 38983539 missense probably damaging 1.00
R6807:Fat4 UTSW 3 38982440 missense probably benign 0.18
R6823:Fat4 UTSW 3 38983939 missense probably benign 0.05
R6824:Fat4 UTSW 3 38957525 missense probably benign 0.00
R6830:Fat4 UTSW 3 38981817 missense probably benign 0.00
R6925:Fat4 UTSW 3 38996204 critical splice donor site probably null
R6948:Fat4 UTSW 3 39009446 missense probably damaging 1.00
R6970:Fat4 UTSW 3 38981775 missense probably damaging 1.00
R6970:Fat4 UTSW 3 38995971 missense probably damaging 1.00
X0017:Fat4 UTSW 3 39009106 missense probably benign 0.00
X0019:Fat4 UTSW 3 38981040 missense probably damaging 1.00
X0020:Fat4 UTSW 3 39000151 missense probably damaging 1.00
X0024:Fat4 UTSW 3 38942902 missense probably benign 0.43
X0064:Fat4 UTSW 3 38970752 missense probably damaging 1.00
Z1088:Fat4 UTSW 3 38887050 missense possibly damaging 0.88
Z1088:Fat4 UTSW 3 38958492 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCACAGATGGCACCTTTGATC -3'
(R):5'- GAATGCATGGGTCGTGATCC -3'

Sequencing Primer
(F):5'- CAGATGGCACCTTTGATCTGACTG -3'
(R):5'- GTCGTGATCCACAGATTCGAC -3'
Posted On2014-10-01