Incidental Mutation 'R2152:Ptprz1'
ID234375
Institutional Source Beutler Lab
Gene Symbol Ptprz1
Ensembl Gene ENSMUSG00000068748
Gene Nameprotein tyrosine phosphatase, receptor type Z, polypeptide 1
SynonymsPTPzeta, RPTPz, phosphacan, Rptpbeta, DSD-1-PG, PTPbeta, Ptprz, Ptpz
MMRRC Submission 040155-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.662) question?
Stock #R2152 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location22875502-23052916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 23030671 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 1010 (L1010I)
Ref Sequence ENSEMBL: ENSMUSP00000143902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090568] [ENSMUST00000202102]
Predicted Effect probably damaging
Transcript: ENSMUST00000090568
AA Change: L1859I

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088056
Gene: ENSMUSG00000068748
AA Change: L1859I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Carb_anhydrase 38 300 5.12e-99 SMART
FN3 312 397 5.53e-4 SMART
low complexity region 588 609 N/A INTRINSIC
low complexity region 825 837 N/A INTRINSIC
low complexity region 1417 1441 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
Blast:PTPc 1497 1573 1e-12 BLAST
low complexity region 1606 1620 N/A INTRINSIC
transmembrane domain 1637 1659 N/A INTRINSIC
low complexity region 1679 1693 N/A INTRINSIC
PTPc 1720 1991 2.8e-130 SMART
PTPc 2019 2281 1.65e-77 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202102
AA Change: L1010I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143902
Gene: ENSMUSG00000068748
AA Change: L1010I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Carb_anhydrase 38 300 5.12e-99 SMART
FN3 312 397 5.53e-4 SMART
low complexity region 588 609 N/A INTRINSIC
transmembrane domain 788 810 N/A INTRINSIC
low complexity region 830 844 N/A INTRINSIC
PTPc 871 1142 2.8e-130 SMART
PTPc 1170 1432 1.65e-77 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine phosphatase family. Expression of this gene is restricted to the central nervous system (CNS), and it may be involved in the regulation of specific developmental processes in the CNS. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for targeted null mutations demonstrate an impaired ability to recover from inflamatory lesions of the CNS or gastric mucosa. Mice homozygous for a knock-out allele exhibit increased tactile and thermal nociception thresholds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,066,934 D298V probably damaging Het
Ackr3 A T 1: 90,213,843 Y8F probably benign Het
Acy1 T C 9: 106,435,617 E175G probably damaging Het
Add2 T C 6: 86,098,598 L243P probably damaging Het
Adsl A G 15: 80,967,662 D407G probably damaging Het
Afg3l1 T G 8: 123,494,836 I478S probably damaging Het
Arfrp1 T C 2: 181,359,694 T108A probably benign Het
Art5 A G 7: 102,098,200 L124P possibly damaging Het
Asap2 A T 12: 21,112,083 T14S probably damaging Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Bbs12 G T 3: 37,321,160 E586* probably null Het
Bicd2 G T 13: 49,379,576 C546F probably damaging Het
Bid A T 6: 120,900,254 L42Q probably damaging Het
Bpifb9a A G 2: 154,260,135 K51E probably benign Het
Calcr G T 6: 3,687,615 T424K probably benign Het
Cd46 A G 1: 195,062,413 I339T probably benign Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cntn3 A G 6: 102,206,537 I719T probably damaging Het
Cyb5r1 T C 1: 134,409,625 I163T possibly damaging Het
Cyp2d26 A T 15: 82,792,706 probably null Het
Dclk1 A G 3: 55,247,212 Y21C probably damaging Het
Dgcr2 G A 16: 17,891,487 probably null Het
Dhx38 T C 8: 109,560,674 S221G probably benign Het
Dis3l T A 9: 64,307,263 N981I probably benign Het
Dnah3 C T 7: 119,952,013 V3028I probably benign Het
Dnah6 T C 6: 73,049,166 Y3448C probably benign Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Doxl2 T A 6: 48,976,539 I466N probably damaging Het
Epb41l1 A G 2: 156,514,128 D528G probably damaging Het
Fat4 A T 3: 38,983,395 Y3732F probably damaging Het
Fgfr4 A T 13: 55,166,964 Y640F probably damaging Het
Foxo6 T A 4: 120,268,614 D328V probably benign Het
Foxp1 A G 6: 99,016,541 L134P probably damaging Het
Frem2 G A 3: 53,517,029 R2996* probably null Het
Fuk T A 8: 110,889,072 T542S probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gcn1l1 T A 5: 115,609,829 I1765N probably benign Het
Gm4787 T A 12: 81,377,219 I722F probably benign Het
Gpc6 G T 14: 116,926,092 A53S probably benign Het
Gtpbp8 A G 16: 44,740,027 probably null Het
H2-Q2 T C 17: 35,345,276 probably null Het
Hapln2 C A 3: 88,023,613 R157L probably benign Het
Hemgn C A 4: 46,396,607 E210* probably null Het
Hpse T A 5: 100,691,403 K360* probably null Het
Iqcj A T 3: 68,055,310 E68V probably damaging Het
Kat2a T C 11: 100,712,346 probably benign Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Kcnab1 A T 3: 65,371,440 I371F probably damaging Het
Klhl30 C A 1: 91,357,824 A356D probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Mgea5 A T 19: 45,758,022 Y779* probably null Het
Micu1 G T 10: 59,863,288 M468I probably benign Het
Mrc1 A G 2: 14,327,864 T1292A probably damaging Het
Myh8 G A 11: 67,294,469 E849K probably damaging Het
Myom3 G T 4: 135,803,233 R1152L probably benign Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nlrp4g T A 9: 124,353,339 noncoding transcript Het
Olfr1339 C T 4: 118,735,249 A240V possibly damaging Het
Olfr1413 T C 1: 92,573,908 S246P probably damaging Het
Olfr24 T C 9: 18,755,095 D180G probably damaging Het
Olfr33 G T 7: 102,713,581 H277Q probably benign Het
Olfr435 A G 6: 43,202,069 I142V probably benign Het
Olfr592 A T 7: 103,186,640 D13V probably benign Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Olfr969 A T 9: 39,795,647 I91F probably benign Het
Otop1 T A 5: 38,302,851 M587K probably damaging Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phc2 A G 4: 128,745,066 *41W probably null Het
Piezo2 A T 18: 63,114,041 M532K probably damaging Het
Pjvk A T 2: 76,658,369 I295F probably benign Het
Popdc2 A G 16: 38,363,120 N155S possibly damaging Het
Ppp4r3a G T 12: 101,042,567 N684K probably damaging Het
Prpf4b T A 13: 34,900,419 M930K probably benign Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Rabepk A T 2: 34,784,550 D232E possibly damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Rb1 T C 14: 73,288,725 T169A probably benign Het
Rcc2 T C 4: 140,717,117 L373P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rrbp1 A G 2: 143,954,198 L1200P possibly damaging Het
Sdk1 A G 5: 141,792,944 N226D probably damaging Het
Selenbp1 G A 3: 94,944,130 R398H probably damaging Het
Selenoo A G 15: 89,099,282 M509V probably benign Het
Sidt2 T C 9: 45,945,340 D477G probably damaging Het
Slc2a5 T G 4: 150,125,638 S27A probably damaging Het
Slc30a5 A T 13: 100,803,949 H619Q probably damaging Het
Slc5a9 A G 4: 111,893,223 I146T possibly damaging Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Snx29 A G 16: 11,400,843 D181G possibly damaging Het
Spata31d1c G A 13: 65,033,965 probably null Het
Stat5a C A 11: 100,874,090 T213N probably benign Het
Stt3a A T 9: 36,747,996 V349D probably damaging Het
Tcf20 A T 15: 82,855,602 D549E probably damaging Het
Thbs2 T A 17: 14,673,209 D903V probably damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tmc1 A T 19: 20,856,675 N241K probably benign Het
Tmem260 G T 14: 48,477,609 R240L possibly damaging Het
Tnfaip6 A T 2: 52,043,730 E32D probably damaging Het
Trpa1 A T 1: 14,899,401 H381Q probably damaging Het
Tsen2 T C 6: 115,547,975 I45T possibly damaging Het
Ttc6 G A 12: 57,705,552 V1415I probably damaging Het
Ttll7 G T 3: 146,930,189 R426L probably damaging Het
Ttn A C 2: 76,740,138 S26804A probably damaging Het
Ubqlnl A T 7: 104,148,683 C536S probably benign Het
Vmn2r73 A G 7: 85,857,728 V792A probably benign Het
Zfp345 T C 2: 150,472,658 T320A probably benign Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Other mutations in Ptprz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Ptprz1 APN 6 22973054 missense probably damaging 1.00
IGL00773:Ptprz1 APN 6 23002629 missense probably benign 0.41
IGL01458:Ptprz1 APN 6 22972844 missense probably damaging 0.99
IGL01481:Ptprz1 APN 6 22999980 missense probably benign 0.05
IGL01501:Ptprz1 APN 6 22973082 missense probably damaging 1.00
IGL01601:Ptprz1 APN 6 23000438 missense probably damaging 0.99
IGL01882:Ptprz1 APN 6 23000464 missense probably damaging 1.00
IGL02058:Ptprz1 APN 6 23002503 missense probably benign 0.00
IGL02089:Ptprz1 APN 6 23033448 missense probably damaging 1.00
IGL02136:Ptprz1 APN 6 22972822 missense probably damaging 1.00
IGL02215:Ptprz1 APN 6 22965182 missense possibly damaging 0.91
IGL02220:Ptprz1 APN 6 23042743 splice site probably benign
IGL02556:Ptprz1 APN 6 22972845 missense probably benign 0.01
IGL02601:Ptprz1 APN 6 23000687 missense probably benign 0.11
IGL02620:Ptprz1 APN 6 22959740 missense probably damaging 1.00
IGL02666:Ptprz1 APN 6 23001210 missense probably benign 0.00
IGL02718:Ptprz1 APN 6 23001349 missense possibly damaging 0.77
IGL02792:Ptprz1 APN 6 22959723 missense probably damaging 1.00
IGL02894:Ptprz1 APN 6 23035149 missense probably damaging 1.00
IGL02952:Ptprz1 APN 6 23036926 missense probably damaging 1.00
IGL03003:Ptprz1 APN 6 23002583 missense probably damaging 0.98
IGL03060:Ptprz1 APN 6 22972835 missense probably damaging 1.00
IGL03170:Ptprz1 APN 6 22959767 missense probably benign 0.00
IGL03246:Ptprz1 APN 6 22986160 missense probably damaging 0.99
IGL03349:Ptprz1 APN 6 23000332 missense probably damaging 1.00
IGL03365:Ptprz1 APN 6 23030582 splice site probably benign
R0044:Ptprz1 UTSW 6 23007403 missense probably damaging 1.00
R0054:Ptprz1 UTSW 6 22986196 missense probably damaging 1.00
R0054:Ptprz1 UTSW 6 22986196 missense probably damaging 1.00
R0107:Ptprz1 UTSW 6 23000570 missense probably damaging 0.98
R0278:Ptprz1 UTSW 6 23000817 missense probably benign 0.31
R0345:Ptprz1 UTSW 6 23016165 missense probably damaging 1.00
R0359:Ptprz1 UTSW 6 22973176 splice site probably benign
R0743:Ptprz1 UTSW 6 23044367 nonsense probably null
R1014:Ptprz1 UTSW 6 23000644 missense probably damaging 1.00
R1016:Ptprz1 UTSW 6 23000974 missense probably damaging 1.00
R1106:Ptprz1 UTSW 6 22965749 missense probably damaging 0.99
R1391:Ptprz1 UTSW 6 23001729 missense probably benign 0.33
R1424:Ptprz1 UTSW 6 23000383 missense probably benign 0.00
R1445:Ptprz1 UTSW 6 23050474 missense probably damaging 1.00
R1496:Ptprz1 UTSW 6 23049524 splice site probably benign
R1544:Ptprz1 UTSW 6 23000748 missense possibly damaging 0.63
R1626:Ptprz1 UTSW 6 23001574 missense probably benign
R1641:Ptprz1 UTSW 6 23049606 missense probably damaging 1.00
R1757:Ptprz1 UTSW 6 23044320 missense probably damaging 1.00
R1812:Ptprz1 UTSW 6 22959712 missense probably benign 0.07
R1917:Ptprz1 UTSW 6 23035040 splice site probably benign
R1930:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R1931:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R1974:Ptprz1 UTSW 6 22986311 missense probably damaging 1.00
R1992:Ptprz1 UTSW 6 22959748 missense probably benign 0.24
R1997:Ptprz1 UTSW 6 23050497 missense probably damaging 0.99
R2002:Ptprz1 UTSW 6 23027834 nonsense probably null
R2012:Ptprz1 UTSW 6 23001027 missense probably benign 0.03
R2059:Ptprz1 UTSW 6 22986323 splice site probably benign
R2061:Ptprz1 UTSW 6 23049675 critical splice donor site probably null
R2064:Ptprz1 UTSW 6 23050389 splice site probably benign
R2067:Ptprz1 UTSW 6 23050389 splice site probably benign
R2108:Ptprz1 UTSW 6 23033477 missense probably damaging 0.99
R2166:Ptprz1 UTSW 6 23045633 missense possibly damaging 0.90
R2183:Ptprz1 UTSW 6 23002285 missense probably benign
R2202:Ptprz1 UTSW 6 23000650 missense possibly damaging 0.63
R2238:Ptprz1 UTSW 6 22987377 missense probably damaging 1.00
R2290:Ptprz1 UTSW 6 23000991 missense probably damaging 1.00
R3027:Ptprz1 UTSW 6 23016197 missense possibly damaging 0.89
R3861:Ptprz1 UTSW 6 23036895 missense probably damaging 0.98
R4012:Ptprz1 UTSW 6 23002585 missense probably damaging 0.99
R4020:Ptprz1 UTSW 6 22959624 splice site probably benign
R4158:Ptprz1 UTSW 6 23001684 nonsense probably null
R4158:Ptprz1 UTSW 6 23022205 missense possibly damaging 0.73
R4159:Ptprz1 UTSW 6 23001684 nonsense probably null
R4160:Ptprz1 UTSW 6 23022205 missense possibly damaging 0.73
R4606:Ptprz1 UTSW 6 23001487 missense possibly damaging 0.80
R4621:Ptprz1 UTSW 6 23001454 missense possibly damaging 0.68
R4640:Ptprz1 UTSW 6 22972798 missense probably damaging 1.00
R4731:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4732:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4733:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4803:Ptprz1 UTSW 6 23001546 missense probably benign 0.00
R4890:Ptprz1 UTSW 6 23024958 missense probably damaging 1.00
R5035:Ptprz1 UTSW 6 23016215 missense probably benign 0.06
R5052:Ptprz1 UTSW 6 23045626 missense probably damaging 1.00
R5106:Ptprz1 UTSW 6 23000028 missense probably benign 0.04
R5248:Ptprz1 UTSW 6 23001901 missense probably benign 0.11
R5292:Ptprz1 UTSW 6 23002582 missense probably benign 0.31
R5373:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R5374:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R5378:Ptprz1 UTSW 6 23007402 missense probably damaging 1.00
R5408:Ptprz1 UTSW 6 23002600 missense probably damaging 1.00
R5479:Ptprz1 UTSW 6 23001666 missense probably benign
R5524:Ptprz1 UTSW 6 22986318 splice site probably null
R5527:Ptprz1 UTSW 6 23000053 missense possibly damaging 0.66
R5557:Ptprz1 UTSW 6 23001001 missense probably benign 0.04
R5654:Ptprz1 UTSW 6 22986134 missense probably damaging 1.00
R5655:Ptprz1 UTSW 6 22999773 missense probably benign 0.00
R5658:Ptprz1 UTSW 6 23016189 missense probably damaging 1.00
R5663:Ptprz1 UTSW 6 23035143 missense probably damaging 1.00
R5765:Ptprz1 UTSW 6 23000236 missense probably damaging 1.00
R5822:Ptprz1 UTSW 6 23001445 missense probably benign 0.01
R5837:Ptprz1 UTSW 6 23001418 missense probably benign 0.00
R6108:Ptprz1 UTSW 6 23045659 missense probably damaging 1.00
R6199:Ptprz1 UTSW 6 23002471 missense probably benign 0.01
R6245:Ptprz1 UTSW 6 23051990 missense probably damaging 1.00
R6257:Ptprz1 UTSW 6 22959640 missense probably damaging 1.00
R6488:Ptprz1 UTSW 6 23001517 nonsense probably null
R6606:Ptprz1 UTSW 6 23002501 missense probably benign 0.27
R6612:Ptprz1 UTSW 6 23052082 missense probably damaging 1.00
R6824:Ptprz1 UTSW 6 23002131 missense probably benign 0.05
R6834:Ptprz1 UTSW 6 22999633 missense probably benign 0.38
R6836:Ptprz1 UTSW 6 23030665 nonsense probably null
R6991:Ptprz1 UTSW 6 23002687 missense probably benign 0.00
R7044:Ptprz1 UTSW 6 23044346 missense probably damaging 1.00
R7048:Ptprz1 UTSW 6 22961623 missense probably benign 0.18
R7225:Ptprz1 UTSW 6 23000929 missense possibly damaging 0.61
R7284:Ptprz1 UTSW 6 23000098 missense probably damaging 1.00
R7360:Ptprz1 UTSW 6 23000907 missense probably damaging 1.00
R7501:Ptprz1 UTSW 6 23001747 nonsense probably null
R7515:Ptprz1 UTSW 6 23022267 missense probably damaging 1.00
R7538:Ptprz1 UTSW 6 22999896 missense possibly damaging 0.81
R7567:Ptprz1 UTSW 6 22959780 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTTCATGTCACTGTCCCAAAC -3'
(R):5'- CATGCAGCTTTTCTCCACGG -3'

Sequencing Primer
(F):5'- ATGTCACTGTCCCAAACCTTTAC -3'
(R):5'- TCCACGGCCTCTGCATTAGG -3'
Posted On2014-10-01