Incidental Mutation 'R0196:Olfr392'
ID23454
Institutional Source Beutler Lab
Gene Symbol Olfr392
Ensembl Gene ENSMUSG00000061984
Gene Nameolfactory receptor 392
SynonymsGA_x6K02T2P1NL-3966976-3966038, MOR135-9
MMRRC Submission 038455-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0196 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73811740-73817049 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73814905 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 59 (M59K)
Ref Sequence ENSEMBL: ENSMUSP00000123649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118463] [ENSMUST00000144724]
Predicted Effect probably damaging
Transcript: ENSMUST00000118463
AA Change: M59K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113118
Gene: ENSMUSG00000061984
AA Change: M59K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.6e-6 PFAM
Pfam:7tm_1 41 290 1.2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144724
AA Change: M59K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123649
Gene: ENSMUSG00000061984
AA Change: M59K

DomainStartEndE-ValueType
Pfam:7tm_1 41 116 2e-12 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 81.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,616,247 probably benign Het
Aass G A 6: 23,109,520 P317L probably damaging Het
Abca12 T A 1: 71,259,813 N2313I possibly damaging Het
Adamts12 T C 15: 11,071,508 I46T probably benign Het
Adipoq T G 16: 23,146,643 probably null Het
Amy1 A T 3: 113,569,421 D92E probably benign Het
Asb15 G A 6: 24,564,393 R282Q probably damaging Het
Bag6 G C 17: 35,144,263 G693A probably damaging Het
Birc6 T C 17: 74,580,287 I870T possibly damaging Het
Cand2 A G 6: 115,789,502 K356R probably damaging Het
Cbfa2t3 T C 8: 122,633,337 Q525R possibly damaging Het
Ccdc94 C A 17: 55,964,653 D191E probably damaging Het
Cd4 T C 6: 124,867,806 R339G probably damaging Het
Cdh8 A G 8: 99,190,434 S350P probably damaging Het
Cep295 A T 9: 15,338,213 S469T probably damaging Het
Ckap2l A T 2: 129,285,422 S279T probably benign Het
Clnk T A 5: 38,769,939 N66Y probably damaging Het
Col27a1 A T 4: 63,224,266 T64S probably benign Het
Crtc1 T C 8: 70,386,221 D599G probably damaging Het
Cyp2c23 A C 19: 44,012,356 I363S probably damaging Het
Dnah10 A T 5: 124,834,075 I4519F possibly damaging Het
Dner T A 1: 84,370,832 I716F probably damaging Het
Dsel T G 1: 111,861,603 T401P possibly damaging Het
Egfr A G 11: 16,911,746 D1175G probably benign Het
Ephb3 A T 16: 21,218,054 N343I probably damaging Het
Fbxw10 T A 11: 62,877,244 F974I probably benign Het
Gfi1b T C 2: 28,613,774 Y138C probably damaging Het
Gm11168 T A 9: 3,005,175 L6H probably benign Het
Grb10 A C 11: 11,945,583 V247G probably damaging Het
Gstp2 A T 19: 4,040,514 probably null Het
Hars2 C T 18: 36,789,204 Q291* probably null Het
Hyal4 G T 6: 24,756,221 W146L probably damaging Het
Il22ra1 C T 4: 135,734,245 T107I possibly damaging Het
Itga8 A G 2: 12,204,729 probably null Het
Klhl25 T C 7: 75,865,702 S119P probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lrrc8c T C 5: 105,606,770 V137A probably benign Het
Macrod2 A T 2: 142,176,625 E226V probably damaging Het
Mcemp1 A T 8: 3,668,201 Q165L probably benign Het
Mcpt9 T A 14: 56,027,996 K82M probably benign Het
Mpzl3 A G 9: 45,062,160 T66A probably damaging Het
Msh6 G A 17: 87,980,360 V143I possibly damaging Het
Mug1 G A 6: 121,838,725 probably null Het
Ncr1 G T 7: 4,340,973 C153F probably damaging Het
Nf1 T A 11: 79,468,769 M1411K possibly damaging Het
Nf1 T A 11: 79,578,272 V786D probably damaging Het
Nisch T C 14: 31,203,394 probably benign Het
Nwd2 T A 5: 63,806,351 Y1093N probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Oxa1l T C 14: 54,363,487 I139T probably damaging Het
P3h3 T A 6: 124,845,272 N583Y probably damaging Het
Pcdh18 A T 3: 49,756,698 probably null Het
Pcnp C T 16: 56,024,533 probably benign Het
Pdzd8 G T 19: 59,301,131 D612E probably benign Het
Pi4kb T C 3: 94,998,950 S8P probably damaging Het
Pikfyve T G 1: 65,256,072 V1454G possibly damaging Het
Podn T C 4: 108,021,498 N246D probably damaging Het
Prg4 T C 1: 150,454,492 probably benign Het
R3hdm2 T C 10: 127,484,521 Y523H probably damaging Het
Rpf1 T A 3: 146,508,149 E231V possibly damaging Het
Slc16a10 C T 10: 40,056,615 E317K probably benign Het
Slc34a1 A T 13: 55,412,265 I435F probably damaging Het
Snx19 A G 9: 30,433,387 D629G probably damaging Het
Tomm70a T C 16: 57,146,100 I472T probably benign Het
Trp53 A G 11: 69,588,680 Y202C probably damaging Het
Ttc14 T A 3: 33,809,254 probably benign Het
Ugt1a1 C T 1: 88,212,555 A185V possibly damaging Het
Usp28 A G 9: 49,028,278 D655G probably damaging Het
Vmn1r215 C T 13: 23,076,084 T98I probably damaging Het
Vmn2r121 G T X: 124,132,182 T426N probably benign Het
Vmn2r99 A G 17: 19,394,573 N852D probably benign Het
Xrn2 T A 2: 147,047,660 D654E probably damaging Het
Zfp335 C G 2: 164,896,145 A849P possibly damaging Het
Zfp954 C T 7: 7,115,391 V385M probably damaging Het
Zmynd15 A G 11: 70,464,226 T350A probably damaging Het
Other mutations in Olfr392
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Olfr392 APN 11 73814786 missense probably damaging 0.97
IGL02976:Olfr392 APN 11 73814317 missense probably damaging 0.98
IGL03344:Olfr392 APN 11 73814177 missense probably benign 0.21
R0347:Olfr392 UTSW 11 73814311 missense probably damaging 0.98
R0594:Olfr392 UTSW 11 73814617 missense probably benign 0.12
R0940:Olfr392 UTSW 11 73814224 missense probably damaging 1.00
R1233:Olfr392 UTSW 11 73814350 missense probably damaging 1.00
R1300:Olfr392 UTSW 11 73814246 missense probably benign 0.13
R1490:Olfr392 UTSW 11 73814371 missense possibly damaging 0.95
R3111:Olfr392 UTSW 11 73814186 missense probably benign
R4827:Olfr392 UTSW 11 73814721 nonsense probably null
R4852:Olfr392 UTSW 11 73814248 missense probably benign 0.11
R4992:Olfr392 UTSW 11 73814320 missense probably damaging 1.00
R6193:Olfr392 UTSW 11 73814824 missense probably benign
R7201:Olfr392 UTSW 11 73814341 missense probably benign 0.19
R7310:Olfr392 UTSW 11 73814286 missense probably damaging 0.98
X0021:Olfr392 UTSW 11 73814305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGCAGGACAACTTCAGAAGAGC -3'
(R):5'- CATACAGTCTCAACCACTGGGTGC -3'

Sequencing Primer
(F):5'- GGCATGGAATATAGTCAACATCC -3'
(R):5'- CTTAAAGTCATAGGAGGCATGACTG -3'
Posted On2013-04-16