Incidental Mutation 'R2153:Dlg5'
ID234551
Institutional Source Beutler Lab
Gene Symbol Dlg5
Ensembl Gene ENSMUSG00000021782
Gene Namediscs large MAGUK scaffold protein 5
Synonyms4933429D20Rik
MMRRC Submission 040156-MU
Accession Numbers

Genbank: NM_001163513; MGI: 1918478

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2153 (G1)
Quality Score196
Status Not validated
Chromosome14
Chromosomal Location24133953-24245920 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24137157 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1819 (I1819N)
Ref Sequence ENSEMBL: ENSMUSP00000073367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042009] [ENSMUST00000073687] [ENSMUST00000090398]
Predicted Effect probably damaging
Transcript: ENSMUST00000042009
AA Change: I1493N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044852
Gene: ENSMUSG00000021782
AA Change: I1493N

DomainStartEndE-ValueType
coiled coil region 20 247 N/A INTRINSIC
low complexity region 261 274 N/A INTRINSIC
PDZ 279 356 2.02e-10 SMART
PDZ 364 447 9.5e-16 SMART
low complexity region 510 517 N/A INTRINSIC
low complexity region 692 711 N/A INTRINSIC
low complexity region 903 918 N/A INTRINSIC
PDZ 1009 1080 2.1e-17 SMART
PDZ 1164 1236 2.97e-8 SMART
SH3 1250 1314 3.73e-7 SMART
low complexity region 1338 1358 N/A INTRINSIC
GuKc 1375 1561 5.43e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073687
AA Change: I1819N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073367
Gene: ENSMUSG00000021782
AA Change: I1819N

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 22 36 N/A INTRINSIC
low complexity region 44 66 N/A INTRINSIC
Pfam:Takusan 104 191 1.4e-27 PFAM
coiled coil region 308 578 N/A INTRINSIC
low complexity region 592 605 N/A INTRINSIC
PDZ 610 687 2.02e-10 SMART
PDZ 695 773 1.25e-15 SMART
low complexity region 836 843 N/A INTRINSIC
low complexity region 1018 1037 N/A INTRINSIC
low complexity region 1229 1244 N/A INTRINSIC
PDZ 1335 1406 2.1e-17 SMART
PDZ 1490 1562 2.97e-8 SMART
SH3 1576 1640 3.73e-7 SMART
low complexity region 1664 1684 N/A INTRINSIC
GuKc 1701 1887 5.43e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090398
AA Change: I1842N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087879
Gene: ENSMUSG00000021782
AA Change: I1842N

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 22 36 N/A INTRINSIC
low complexity region 44 66 N/A INTRINSIC
low complexity region 109 123 N/A INTRINSIC
Pfam:Takusan 128 213 6e-33 PFAM
coiled coil region 331 601 N/A INTRINSIC
low complexity region 615 628 N/A INTRINSIC
PDZ 633 710 2.02e-10 SMART
PDZ 718 796 1.25e-15 SMART
low complexity region 859 866 N/A INTRINSIC
low complexity region 1041 1060 N/A INTRINSIC
low complexity region 1252 1267 N/A INTRINSIC
PDZ 1358 1429 2.1e-17 SMART
PDZ 1513 1585 2.97e-8 SMART
SH3 1599 1663 3.73e-7 SMART
low complexity region 1687 1707 N/A INTRINSIC
GuKc 1724 1910 5.43e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166007
SMART Domains Protein: ENSMUSP00000127054
Gene: ENSMUSG00000021782

DomainStartEndE-ValueType
low complexity region 41 61 N/A INTRINSIC
GuKc 78 224 6.17e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of discs large (DLG) homologs, a subset of the membrane-associated guanylate kinase (MAGUK) superfamily. The MAGUK proteins are composed of a catalytically inactive guanylate kinase domain, in addition to PDZ and SH3 domains, and are thought to function as scaffolding molecules at sites of cell-cell contact. The protein encoded by this gene localizes to the plasma membrane and cytoplasm, and interacts with components of adherens junctions and the cytoskeleton. It is proposed to function in the transmission of extracellular signals to the cytoskeleton and in the maintenance of epithelial cell structure. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit growth retardation, hydroencephaly, abnormal brain morphology, abnormal neurogenesis, kidney cysts, ureter defects, and abnormal kidney morphology. [provided by MGI curators]
Allele List at MGI

All alleles(19) : Targeted, other(1) Gene trapped(18)

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,115 E363G probably benign Het
9930021J03Rik T C 19: 29,716,829 M1755V probably benign Het
Abcg2 T A 6: 58,684,322 probably null Het
Adgrg7 T G 16: 56,752,428 I342L possibly damaging Het
Akap6 A C 12: 53,141,404 D1867A probably benign Het
Ankrd17 A T 5: 90,234,059 V2416D probably damaging Het
Apaf1 A G 10: 91,048,090 V670A probably damaging Het
Art5 A G 7: 102,098,200 L124P possibly damaging Het
Atad5 T A 11: 80,106,377 D842E probably benign Het
Capns1 A G 7: 30,192,340 L124P probably damaging Het
Carmil1 A G 13: 24,141,673 S225P probably damaging Het
Cars2 C T 8: 11,530,299 A247T possibly damaging Het
Cd46 A G 1: 195,062,413 I339T probably benign Het
Ceacam14 C A 7: 17,814,228 T81N probably benign Het
Ceacam16 G A 7: 19,861,141 P4L probably benign Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cntnap5c A T 17: 58,055,671 I340L possibly damaging Het
Col2a1 C A 15: 97,987,580 A461S unknown Het
Comtd1 T C 14: 21,848,272 E27G possibly damaging Het
Cyp2a12 A G 7: 27,032,617 N261S probably benign Het
Dclk1 A G 3: 55,247,212 Y21C probably damaging Het
Dis3l T A 9: 64,307,263 N981I probably benign Het
Enpep T C 3: 129,280,582 N772S probably damaging Het
Erich1 T C 8: 14,078,773 T56A probably benign Het
Ermp1 T C 19: 29,637,398 probably null Het
Etl4 A G 2: 20,798,734 E807G probably benign Het
Fat4 A T 3: 38,983,395 Y3732F probably damaging Het
Fbxw18 T G 9: 109,693,370 T144P probably damaging Het
Flywch1 A T 17: 23,755,650 I672K probably benign Het
Foxk2 C A 11: 121,260,387 A86E probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gda A G 19: 21,397,505 probably null Het
Gna15 T C 10: 81,502,904 Y367C probably damaging Het
Golga3 A G 5: 110,187,990 probably null Het
Greb1 T C 12: 16,699,532 S1098G probably damaging Het
Hook3 C A 8: 26,070,197 L333F probably damaging Het
Ikbkap T A 4: 56,779,636 probably null Het
Il6 C T 5: 30,013,504 Q33* probably null Het
Iqgap1 T C 7: 80,751,953 E468G probably benign Het
Iqgap1 A G 7: 80,759,903 I228T possibly damaging Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Kcnab1 A T 3: 65,371,440 I371F probably damaging Het
Kcnj10 A T 1: 172,369,888 Y323F possibly damaging Het
Klk1b5 T C 7: 44,219,898 probably null Het
Lmo7 A G 14: 101,920,515 probably benign Het
Loxhd1 A T 18: 77,356,166 T277S possibly damaging Het
Lrp5 A T 19: 3,614,339 M796K probably benign Het
Med15 A T 16: 17,685,451 probably null Het
Mfn1 T A 3: 32,542,826 H144Q probably damaging Het
Mmp25 T A 17: 23,631,074 Y504F probably damaging Het
Nmi T C 2: 51,952,543 E179G probably damaging Het
Nrxn2 T C 19: 6,504,914 I1141T probably damaging Het
Olah T C 2: 3,365,269 S9G probably benign Het
Olfr1054 A C 2: 86,332,528 F276C probably damaging Het
Olfr1204 C A 2: 88,852,784 P278H probably damaging Het
Olfr1477 T G 19: 13,502,488 I48M probably damaging Het
Olfr24 T C 9: 18,755,095 D180G probably damaging Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Otog T A 7: 46,302,904 C2591S probably damaging Het
Pdgfrb G T 18: 61,072,756 V605F probably damaging Het
Pik3cb T A 9: 99,101,244 K104* probably null Het
Plb1 T A 5: 32,314,089 I580N probably damaging Het
Plekha2 T C 8: 25,088,397 Y29C probably damaging Het
Plekha7 T A 7: 116,175,767 Y213F probably damaging Het
Plin5 T C 17: 56,116,836 D33G probably benign Het
Pnpla2 C A 7: 141,459,219 Q371K probably damaging Het
Ppm1n A G 7: 19,278,185 Y348H probably damaging Het
Ppp2r1b T A 9: 50,866,554 D266E probably damaging Het
Prss23 A G 7: 89,509,911 S317P probably damaging Het
Prss33 C T 17: 23,834,843 V87M probably damaging Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Pum1 G T 4: 130,751,491 A571S probably damaging Het
Rexo1 G T 10: 80,544,109 C13* probably null Het
Rhpn1 A T 15: 75,704,394 M1L probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripk2 A G 4: 16,132,775 probably null Het
Rps6kc1 T C 1: 190,798,723 Y937C probably damaging Het
Rrbp1 A G 2: 143,954,198 L1200P possibly damaging Het
Ryr2 A G 13: 11,577,873 I4665T possibly damaging Het
Sbno1 C A 5: 124,378,543 V1256F probably benign Het
Senp5 T C 16: 31,968,874 I644V probably damaging Het
Serpinb9e T A 13: 33,252,978 F94I probably damaging Het
Sidt2 T C 9: 45,945,340 D477G probably damaging Het
Slc30a5 A T 13: 100,803,949 H619Q probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Sned1 T A 1: 93,274,657 D674E probably benign Het
Sorl1 T C 9: 41,984,492 H1789R probably benign Het
Sp2 T C 11: 96,962,008 D30G possibly damaging Het
Stk33 T A 7: 109,341,320 N61I probably benign Het
Stxbp1 T A 2: 32,802,856 I383F probably damaging Het
Tbcd A G 11: 121,603,631 Q1006R possibly damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tnfrsf21 A G 17: 43,087,872 D623G probably damaging Het
Trib2 A G 12: 15,793,829 F271L probably damaging Het
Ttn A G 2: 76,980,133 V17A probably benign Het
Ubqlnl A T 7: 104,148,683 C536S probably benign Het
Vmn1r230 T A 17: 20,846,801 M84K probably damaging Het
Vmn2r97 A T 17: 18,947,322 R613* probably null Het
Yeats2 T A 16: 20,154,166 D23E probably damaging Het
Zan T A 5: 137,436,400 I2214F unknown Het
Zbtb40 T C 4: 136,991,635 D917G probably damaging Het
Zcchc2 C A 1: 106,021,723 probably null Het
Zdhhc23 G T 16: 43,973,919 Q131K probably benign Het
Zfp345 T C 2: 150,472,658 T320A probably benign Het
Zfp532 A G 18: 65,624,927 T644A possibly damaging Het
Other mutations in Dlg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Dlg5 APN 14 24191161 missense probably damaging 0.99
IGL00164:Dlg5 APN 14 24158464 missense possibly damaging 0.89
IGL00767:Dlg5 APN 14 24165285 missense probably damaging 1.00
IGL01284:Dlg5 APN 14 24146197 missense probably damaging 1.00
IGL01328:Dlg5 APN 14 24202351 missense probably damaging 0.98
IGL01532:Dlg5 APN 14 24158592 missense probably benign
IGL01621:Dlg5 APN 14 24148221 missense probably damaging 1.00
IGL01649:Dlg5 APN 14 24138691 missense probably damaging 1.00
IGL01733:Dlg5 APN 14 24170449 missense probably damaging 1.00
IGL02048:Dlg5 APN 14 24172203 missense possibly damaging 0.87
IGL02103:Dlg5 APN 14 24144346 missense probably damaging 1.00
IGL02138:Dlg5 APN 14 24158351 missense probably benign
IGL02146:Dlg5 APN 14 24202361 missense probably damaging 0.99
IGL02392:Dlg5 APN 14 24150209 missense probably damaging 1.00
IGL02427:Dlg5 APN 14 24166207 missense probably damaging 1.00
IGL02643:Dlg5 APN 14 24191182 missense probably damaging 1.00
IGL02649:Dlg5 APN 14 24146251 missense probably damaging 0.96
IGL02933:Dlg5 APN 14 24158499 missense probably benign 0.06
IGL02965:Dlg5 APN 14 24172023 missense probably damaging 1.00
IGL02988:Dlg5 APN 14 24166255 missense probably damaging 1.00
IGL03351:Dlg5 APN 14 24170454 missense probably benign 0.03
R0123:Dlg5 UTSW 14 24147206 missense probably benign
R0131:Dlg5 UTSW 14 24138649 missense probably damaging 1.00
R0709:Dlg5 UTSW 14 24146255 missense probably damaging 1.00
R0920:Dlg5 UTSW 14 24176397 missense probably damaging 1.00
R0924:Dlg5 UTSW 14 24135577 missense probably damaging 1.00
R0930:Dlg5 UTSW 14 24135577 missense probably damaging 1.00
R0981:Dlg5 UTSW 14 24154631 missense probably damaging 1.00
R1402:Dlg5 UTSW 14 24176608 missense probably benign 0.06
R1402:Dlg5 UTSW 14 24176608 missense probably benign 0.06
R1438:Dlg5 UTSW 14 24154605 missense possibly damaging 0.94
R1449:Dlg5 UTSW 14 24135643 missense possibly damaging 0.82
R1465:Dlg5 UTSW 14 24154696 splice site probably null
R1465:Dlg5 UTSW 14 24154696 splice site probably null
R1543:Dlg5 UTSW 14 24144448 missense probably damaging 1.00
R1824:Dlg5 UTSW 14 24149444 missense probably benign 0.28
R1899:Dlg5 UTSW 14 24148300 missense probably damaging 1.00
R1920:Dlg5 UTSW 14 24176571 missense probably damaging 1.00
R1921:Dlg5 UTSW 14 24176571 missense probably damaging 1.00
R1951:Dlg5 UTSW 14 24156469 splice site probably benign
R1968:Dlg5 UTSW 14 24164119 nonsense probably null
R2049:Dlg5 UTSW 14 24154647 missense probably damaging 1.00
R2070:Dlg5 UTSW 14 24136635 missense probably damaging 1.00
R2117:Dlg5 UTSW 14 24177758 nonsense probably null
R2139:Dlg5 UTSW 14 24170544 missense probably damaging 1.00
R2283:Dlg5 UTSW 14 24158663 missense probably benign 0.00
R2293:Dlg5 UTSW 14 24158112 missense probably benign
R2356:Dlg5 UTSW 14 24170428 critical splice donor site probably null
R2362:Dlg5 UTSW 14 24158687 missense probably benign 0.04
R2513:Dlg5 UTSW 14 24164525 missense probably damaging 1.00
R3084:Dlg5 UTSW 14 24166190 missense probably damaging 1.00
R3086:Dlg5 UTSW 14 24166190 missense probably damaging 1.00
R3750:Dlg5 UTSW 14 24165260 missense probably damaging 1.00
R3780:Dlg5 UTSW 14 24190310 unclassified probably benign
R3782:Dlg5 UTSW 14 24190310 unclassified probably benign
R3828:Dlg5 UTSW 14 24146158 missense probably damaging 0.99
R4079:Dlg5 UTSW 14 24148260 missense possibly damaging 0.94
R4393:Dlg5 UTSW 14 24177989 critical splice acceptor site probably null
R4615:Dlg5 UTSW 14 24158168 missense probably damaging 1.00
R4664:Dlg5 UTSW 14 24137181 missense possibly damaging 0.90
R4712:Dlg5 UTSW 14 24177983 missense possibly damaging 0.94
R4796:Dlg5 UTSW 14 24144383 missense probably damaging 1.00
R4801:Dlg5 UTSW 14 24154689 missense probably damaging 1.00
R4802:Dlg5 UTSW 14 24154689 missense probably damaging 1.00
R4946:Dlg5 UTSW 14 24154361 missense probably damaging 0.99
R5022:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5023:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5057:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5234:Dlg5 UTSW 14 24192862 missense probably damaging 0.98
R5561:Dlg5 UTSW 14 24177792 missense probably benign 0.03
R5567:Dlg5 UTSW 14 24192913 nonsense probably null
R5570:Dlg5 UTSW 14 24192913 nonsense probably null
R5640:Dlg5 UTSW 14 24170461 missense probably damaging 1.00
R5646:Dlg5 UTSW 14 24158699 missense probably damaging 1.00
R5711:Dlg5 UTSW 14 24150648 missense probably damaging 1.00
R5810:Dlg5 UTSW 14 24146254 missense probably damaging 0.99
R5900:Dlg5 UTSW 14 24149447 missense probably damaging 1.00
R5964:Dlg5 UTSW 14 24164089 missense probably benign
R6190:Dlg5 UTSW 14 24190438 missense probably damaging 0.99
R6240:Dlg5 UTSW 14 24149528 intron probably null
R6276:Dlg5 UTSW 14 24164568 missense probably damaging 1.00
R6339:Dlg5 UTSW 14 24158060 missense probably damaging 1.00
R6508:Dlg5 UTSW 14 24138706 missense probably benign 0.45
R6527:Dlg5 UTSW 14 24190448 missense possibly damaging 0.73
R6593:Dlg5 UTSW 14 24150652 missense probably benign 0.01
R6687:Dlg5 UTSW 14 24190373 missense probably damaging 1.00
R6965:Dlg5 UTSW 14 24149430 missense probably damaging 1.00
R7051:Dlg5 UTSW 14 24146195 missense possibly damaging 0.93
R7075:Dlg5 UTSW 14 24177797 missense possibly damaging 0.49
R7149:Dlg5 UTSW 14 24190424 missense probably benign 0.00
R7182:Dlg5 UTSW 14 24244856 missense
R7203:Dlg5 UTSW 14 24138655 missense probably damaging 1.00
R7216:Dlg5 UTSW 14 24136638 nonsense probably null
R7359:Dlg5 UTSW 14 24164547 missense probably damaging 1.00
YA93:Dlg5 UTSW 14 24155133 unclassified probably benign
Z1088:Dlg5 UTSW 14 24158094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTACACAGTTCCTCTAACC -3'
(R):5'- GAAGGTAGAGATGAGTCCCTCC -3'

Sequencing Primer
(F):5'- TCTAACCTGCTGCACCACATG -3'
(R):5'- TCCTGGGGGAGGGGCTG -3'
Posted On2014-10-01