Incidental Mutation 'R2154:Kif16b'
Institutional Source Beutler Lab
Gene Symbol Kif16b
Ensembl Gene ENSMUSG00000038844
Gene Namekinesin family member 16B
Synonyms8430434E15Rik, N-3 kinesin
MMRRC Submission 040157-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2154 (G1)
Quality Score225
Status Not validated
Chromosomal Location142617474-142901531 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142690580 bp
Amino Acid Change Lysine to Arginine at position 1213 (K1213R)
Ref Sequence ENSEMBL: ENSMUSP00000154926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043589] [ENSMUST00000230763]
Predicted Effect probably damaging
Transcript: ENSMUST00000043589
AA Change: K1202R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042551
Gene: ENSMUSG00000038844
AA Change: K1202R

KISc 1 366 4.87e-173 SMART
FHA 477 529 1.43e-1 SMART
coiled coil region 597 809 N/A INTRINSIC
coiled coil region 835 858 N/A INTRINSIC
coiled coil region 941 1022 N/A INTRINSIC
PX 1179 1281 1.58e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000230763
AA Change: K1213R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinesin-like protein that may be involved in intracellular trafficking. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Chimera embryos containing a knock-out allele and derived from tetraploid rescue exhibit lethal growth arrest at the blastocyst stage with abnormal development of the primitive endoderm, epiblast epithelium, and basement membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,115 E363G probably benign Het
Abca3 A G 17: 24,377,719 Y382C probably damaging Het
Abca5 A G 11: 110,292,174 I1019T probably benign Het
Acox3 A T 5: 35,605,224 S481C probably damaging Het
Ankrd7 T A 6: 18,870,031 M261K probably benign Het
Aqr A C 2: 114,137,004 M510R probably damaging Het
Arpc1a A T 5: 145,092,559 T56S probably benign Het
Asap2 A T 12: 21,112,083 T14S probably damaging Het
Aspg A G 12: 112,120,974 E288G probably benign Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Cabcoco1 A G 10: 68,431,262 L205P probably damaging Het
Cant1 A G 11: 118,411,437 L18P probably damaging Het
Cdca2 G A 14: 67,676,976 P945S probably damaging Het
Cfap74 A G 4: 155,429,296 K522E possibly damaging Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cpa6 A T 1: 10,337,322 M330K probably damaging Het
Creb3l4 G T 3: 90,238,485 N246K probably damaging Het
Cyp2c55 T A 19: 39,034,375 V319D probably damaging Het
Dapk1 T A 13: 60,729,503 S519T probably benign Het
Dhx38 T C 8: 109,560,674 S221G probably benign Het
Dis3l T A 9: 64,307,263 N981I probably benign Het
Dock4 T A 12: 40,820,662 V1467E probably damaging Het
Dock4 ACCTGCTCTGCC ACCTGCTCTGCCTGCTCTGCC 12: 40,844,548 probably benign Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Ercc6l2 T C 13: 63,866,007 S631P probably damaging Het
Fat4 A T 3: 38,887,539 S194C probably damaging Het
Fuk T A 8: 110,889,072 T542S probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gdf10 T C 14: 33,934,389 I436T probably damaging Het
Gfod1 T C 13: 43,303,470 T10A possibly damaging Het
Gucy1a1 A G 3: 82,111,151 probably null Het
Heatr5b G T 17: 78,831,444 Q90K probably benign Het
Ikzf3 T A 11: 98,485,649 K211* probably null Het
Itgam A C 7: 128,085,577 D373A probably damaging Het
Itpripl2 A G 7: 118,489,884 F484S probably damaging Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Mmp25 T A 17: 23,631,074 Y504F probably damaging Het
Mtf2 A G 5: 108,080,931 K38E possibly damaging Het
Myh14 A C 7: 44,652,429 probably null Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nfkb1 T C 3: 135,601,479 T562A probably benign Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Pds5a A T 5: 65,650,498 V464E probably damaging Het
Peak1 C T 9: 56,207,212 V452M probably damaging Het
Phf2 T C 13: 48,820,073 Y372C unknown Het
Poc1a T A 9: 106,285,574 probably null Het
Prss33 C T 17: 23,834,843 V87M probably damaging Het
Psmc2 C G 5: 21,803,129 L344V possibly damaging Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Rabgap1 T C 2: 37,475,441 V242A probably damaging Het
Rad1 C A 15: 10,486,635 H39Q possibly damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Samd9l C T 6: 3,372,945 D1439N possibly damaging Het
Sbno1 A T 5: 124,378,511 D1266E probably benign Het
Sidt2 T C 9: 45,945,340 D477G probably damaging Het
Slc22a13 T C 9: 119,208,687 K125R probably benign Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Smg1 A T 7: 118,158,076 probably benign Het
Spinkl A T 18: 44,169,127 N32K probably benign Het
Stxbp1 T A 2: 32,802,856 I383F probably damaging Het
Taf3 C T 2: 9,951,566 E597K possibly damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tmco6 T C 18: 36,741,687 V409A probably benign Het
Tstd2 T C 4: 46,129,235 T198A probably damaging Het
Vmn1r230 T A 17: 20,846,801 M84K probably damaging Het
Vmn1r45 T A 6: 89,933,983 S2C possibly damaging Het
Vmn2r25 T A 6: 123,839,846 T259S probably benign Het
Vmn2r70 A G 7: 85,563,715 S495P possibly damaging Het
Vmn2r97 A T 17: 18,947,322 R613* probably null Het
Yme1l1 T C 2: 23,162,508 L58P probably damaging Het
Zan G A 5: 137,414,249 probably benign Het
Zfhx4 A G 3: 5,401,741 T2320A possibly damaging Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Other mutations in Kif16b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kif16b APN 2 142848035 nonsense probably null
IGL00499:Kif16b APN 2 142857324 missense probably damaging 1.00
IGL00913:Kif16b APN 2 142704007 nonsense probably null
IGL00971:Kif16b APN 2 142711744 missense probably benign 0.01
IGL01712:Kif16b APN 2 142648471 missense probably damaging 1.00
IGL01965:Kif16b APN 2 142848405 missense probably damaging 1.00
IGL02428:Kif16b APN 2 142672360 missense possibly damaging 0.88
IGL02576:Kif16b APN 2 142862545 splice site probably benign
IGL02884:Kif16b APN 2 142702614 splice site probably benign
IGL03065:Kif16b APN 2 142619913 missense probably damaging 1.00
IGL03103:Kif16b APN 2 142862488 missense probably damaging 1.00
IGL03403:Kif16b APN 2 142711869 missense probably damaging 1.00
IGL02835:Kif16b UTSW 2 142712213 missense probably benign 0.00
R0058:Kif16b UTSW 2 142857305 splice site probably null
R0058:Kif16b UTSW 2 142857305 splice site probably null
R0081:Kif16b UTSW 2 142707426 splice site probably benign
R0123:Kif16b UTSW 2 142672375 missense probably benign
R0134:Kif16b UTSW 2 142672375 missense probably benign
R0388:Kif16b UTSW 2 142740937 missense probably damaging 1.00
R0396:Kif16b UTSW 2 142853659 missense probably damaging 1.00
R0502:Kif16b UTSW 2 142712155 missense probably benign 0.00
R1027:Kif16b UTSW 2 142854538 splice site probably benign
R1674:Kif16b UTSW 2 142712953 nonsense probably null
R1752:Kif16b UTSW 2 142690666 missense probably benign 0.01
R2262:Kif16b UTSW 2 142740917 missense probably damaging 1.00
R2401:Kif16b UTSW 2 142756122 missense probably benign 0.04
R3951:Kif16b UTSW 2 142707359 missense probably benign 0.01
R4161:Kif16b UTSW 2 142707404 missense probably benign 0.00
R4697:Kif16b UTSW 2 142690694 missense probably benign 0.09
R4747:Kif16b UTSW 2 142857426 missense probably damaging 1.00
R4808:Kif16b UTSW 2 142857358 missense probably damaging 1.00
R4878:Kif16b UTSW 2 142848003 missense probably damaging 1.00
R5068:Kif16b UTSW 2 142711707 missense probably benign
R5120:Kif16b UTSW 2 142848339 missense probably damaging 1.00
R5358:Kif16b UTSW 2 142740969 missense probably damaging 1.00
R5821:Kif16b UTSW 2 142702666 missense probably damaging 1.00
R5833:Kif16b UTSW 2 142707367 missense probably benign
R5882:Kif16b UTSW 2 142707258 critical splice donor site probably null
R5974:Kif16b UTSW 2 142857381 missense probably damaging 1.00
R6043:Kif16b UTSW 2 142711900 missense probably damaging 1.00
R6230:Kif16b UTSW 2 142849912 missense probably damaging 1.00
R6373:Kif16b UTSW 2 142699698 missense possibly damaging 0.91
R6472:Kif16b UTSW 2 142699948 intron probably benign
R6622:Kif16b UTSW 2 142712442 missense probably benign 0.01
R6654:Kif16b UTSW 2 142701277 intron probably benign
R6912:Kif16b UTSW 2 142700099 intron probably benign
R7003:Kif16b UTSW 2 142758829 missense possibly damaging 0.95
R7265:Kif16b UTSW 2 142714730 missense probably damaging 1.00
R7307:Kif16b UTSW 2 142712931 missense probably benign 0.00
X0058:Kif16b UTSW 2 142758861 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-10-01