Incidental Mutation 'R2154:Slc22a13'
ID234638
Institutional Source Beutler Lab
Gene Symbol Slc22a13
Ensembl Gene ENSMUSG00000074028
Gene Namesolute carrier family 22 (organic cation transporter), member 13
SynonymsOCTL1, ORCTL3, OCTL3
MMRRC Submission 040157-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.030) question?
Stock #R2154 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location119192974-119209098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119208687 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 125 (K125R)
Ref Sequence ENSEMBL: ENSMUSP00000081855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084797] [ENSMUST00000170400]
Predicted Effect probably benign
Transcript: ENSMUST00000084797
AA Change: K125R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000081855
Gene: ENSMUSG00000074028
AA Change: K125R

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 104 514 2.2e-41 PFAM
Pfam:MFS_1 133 468 2.6e-26 PFAM
Pfam:MFS_1 355 537 2.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170400
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic-cation transporter family. It is located in a gene cluster with another member of the family, organic cation transporter like 4. The encoded protein is a transmembrane protein involved in the transport of small molecules. This protein can function to mediate urate uptake and is a high affinity nicotinate exchanger in the kidneys and the intestine. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,115 E363G probably benign Het
Abca3 A G 17: 24,377,719 Y382C probably damaging Het
Abca5 A G 11: 110,292,174 I1019T probably benign Het
Acox3 A T 5: 35,605,224 S481C probably damaging Het
Ankrd7 T A 6: 18,870,031 M261K probably benign Het
Aqr A C 2: 114,137,004 M510R probably damaging Het
Arpc1a A T 5: 145,092,559 T56S probably benign Het
Asap2 A T 12: 21,112,083 T14S probably damaging Het
Aspg A G 12: 112,120,974 E288G probably benign Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Cabcoco1 A G 10: 68,431,262 L205P probably damaging Het
Cant1 A G 11: 118,411,437 L18P probably damaging Het
Cdca2 G A 14: 67,676,976 P945S probably damaging Het
Cfap74 A G 4: 155,429,296 K522E possibly damaging Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cpa6 A T 1: 10,337,322 M330K probably damaging Het
Creb3l4 G T 3: 90,238,485 N246K probably damaging Het
Cyp2c55 T A 19: 39,034,375 V319D probably damaging Het
Dapk1 T A 13: 60,729,503 S519T probably benign Het
Dhx38 T C 8: 109,560,674 S221G probably benign Het
Dis3l T A 9: 64,307,263 N981I probably benign Het
Dock4 T A 12: 40,820,662 V1467E probably damaging Het
Dock4 ACCTGCTCTGCC ACCTGCTCTGCCTGCTCTGCC 12: 40,844,548 probably benign Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Ercc6l2 T C 13: 63,866,007 S631P probably damaging Het
Fat4 A T 3: 38,887,539 S194C probably damaging Het
Fuk T A 8: 110,889,072 T542S probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gdf10 T C 14: 33,934,389 I436T probably damaging Het
Gfod1 T C 13: 43,303,470 T10A possibly damaging Het
Gucy1a1 A G 3: 82,111,151 probably null Het
Heatr5b G T 17: 78,831,444 Q90K probably benign Het
Ikzf3 T A 11: 98,485,649 K211* probably null Het
Itgam A C 7: 128,085,577 D373A probably damaging Het
Itpripl2 A G 7: 118,489,884 F484S probably damaging Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Kif16b T C 2: 142,690,580 K1213R probably damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Mmp25 T A 17: 23,631,074 Y504F probably damaging Het
Mtf2 A G 5: 108,080,931 K38E possibly damaging Het
Myh14 A C 7: 44,652,429 probably null Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nfkb1 T C 3: 135,601,479 T562A probably benign Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Pds5a A T 5: 65,650,498 V464E probably damaging Het
Peak1 C T 9: 56,207,212 V452M probably damaging Het
Phf2 T C 13: 48,820,073 Y372C unknown Het
Poc1a T A 9: 106,285,574 probably null Het
Prss33 C T 17: 23,834,843 V87M probably damaging Het
Psmc2 C G 5: 21,803,129 L344V possibly damaging Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Rabgap1 T C 2: 37,475,441 V242A probably damaging Het
Rad1 C A 15: 10,486,635 H39Q possibly damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Samd9l C T 6: 3,372,945 D1439N possibly damaging Het
Sbno1 A T 5: 124,378,511 D1266E probably benign Het
Sidt2 T C 9: 45,945,340 D477G probably damaging Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Smg1 A T 7: 118,158,076 probably benign Het
Spinkl A T 18: 44,169,127 N32K probably benign Het
Stxbp1 T A 2: 32,802,856 I383F probably damaging Het
Taf3 C T 2: 9,951,566 E597K possibly damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tmco6 T C 18: 36,741,687 V409A probably benign Het
Tstd2 T C 4: 46,129,235 T198A probably damaging Het
Vmn1r230 T A 17: 20,846,801 M84K probably damaging Het
Vmn1r45 T A 6: 89,933,983 S2C possibly damaging Het
Vmn2r25 T A 6: 123,839,846 T259S probably benign Het
Vmn2r70 A G 7: 85,563,715 S495P possibly damaging Het
Vmn2r97 A T 17: 18,947,322 R613* probably null Het
Yme1l1 T C 2: 23,162,508 L58P probably damaging Het
Zan G A 5: 137,414,249 probably benign Het
Zfhx4 A G 3: 5,401,741 T2320A possibly damaging Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Other mutations in Slc22a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02828:Slc22a13 APN 9 119195707 missense probably benign 0.25
IGL02871:Slc22a13 APN 9 119196011 missense probably benign 0.01
R0764:Slc22a13 UTSW 9 119208680 splice site probably null
R1469:Slc22a13 UTSW 9 119193295 missense possibly damaging 0.67
R1469:Slc22a13 UTSW 9 119193295 missense possibly damaging 0.67
R1545:Slc22a13 UTSW 9 119209047 missense probably benign 0.00
R2321:Slc22a13 UTSW 9 119195628 missense possibly damaging 0.61
R3808:Slc22a13 UTSW 9 119196077 missense probably benign
R3840:Slc22a13 UTSW 9 119208789 missense probably benign 0.18
R4736:Slc22a13 UTSW 9 119193632 missense probably damaging 1.00
R6286:Slc22a13 UTSW 9 119208712 nonsense probably null
R6899:Slc22a13 UTSW 9 119196407 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTAGCTATGTACATGCATACAG -3'
(R):5'- TCAACCTAAGTGCCGCTGAG -3'

Sequencing Primer
(F):5'- GCAACAGGTAGCTATATACATGC -3'
(R):5'- AGCTGGCTATAAGCATCC -3'
Posted On2014-10-01