Incidental Mutation 'R2154:Cant1'
ID234642
Institutional Source Beutler Lab
Gene Symbol Cant1
Ensembl Gene ENSMUSG00000025575
Gene Namecalcium activated nucleotidase 1
Synonyms5830420C20Rik, D11Bwg0554e, SCAN-1, Apy1h, Shapy
MMRRC Submission 040157-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R2154 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location118406289-118419086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118411437 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 18 (L18P)
Ref Sequence ENSEMBL: ENSMUSP00000126919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017620] [ENSMUST00000092378] [ENSMUST00000106287] [ENSMUST00000106288] [ENSMUST00000106289] [ENSMUST00000164927]
Predicted Effect probably damaging
Transcript: ENSMUST00000017620
AA Change: L18P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000017620
Gene: ENSMUSG00000025575
AA Change: L18P

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092378
AA Change: L18P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000090032
Gene: ENSMUSG00000025575
AA Change: L18P

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106287
AA Change: L18P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101894
Gene: ENSMUSG00000025575
AA Change: L18P

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106288
AA Change: L18P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101895
Gene: ENSMUSG00000025575
AA Change: L18P

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106289
AA Change: L18P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101896
Gene: ENSMUSG00000025575
AA Change: L18P

DomainStartEndE-ValueType
Pfam:Apyrase 115 216 6.3e-39 PFAM
Pfam:Apyrase 244 440 3.4e-92 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164927
AA Change: L18P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126919
Gene: ENSMUSG00000025575
AA Change: L18P

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a calcium-dependent nucleotidase that preferentially hydrolyzes UDP, GDP, and IDP. The encoded protein has low activity with ADP and ATP and shows no activity with AMP and GMP. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 72,455,115 E363G probably benign Het
Abca3 A G 17: 24,377,719 Y382C probably damaging Het
Abca5 A G 11: 110,292,174 I1019T probably benign Het
Acox3 A T 5: 35,605,224 S481C probably damaging Het
Ankrd7 T A 6: 18,870,031 M261K probably benign Het
Aqr A C 2: 114,137,004 M510R probably damaging Het
Arpc1a A T 5: 145,092,559 T56S probably benign Het
Asap2 A T 12: 21,112,083 T14S probably damaging Het
Aspg A G 12: 112,120,974 E288G probably benign Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Cabcoco1 A G 10: 68,431,262 L205P probably damaging Het
Cdca2 G A 14: 67,676,976 P945S probably damaging Het
Cfap74 A G 4: 155,429,296 K522E possibly damaging Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cpa6 A T 1: 10,337,322 M330K probably damaging Het
Creb3l4 G T 3: 90,238,485 N246K probably damaging Het
Cyp2c55 T A 19: 39,034,375 V319D probably damaging Het
Dapk1 T A 13: 60,729,503 S519T probably benign Het
Dhx38 T C 8: 109,560,674 S221G probably benign Het
Dis3l T A 9: 64,307,263 N981I probably benign Het
Dock4 T A 12: 40,820,662 V1467E probably damaging Het
Dock4 ACCTGCTCTGCC ACCTGCTCTGCCTGCTCTGCC 12: 40,844,548 probably benign Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Ercc6l2 T C 13: 63,866,007 S631P probably damaging Het
Fat4 A T 3: 38,887,539 S194C probably damaging Het
Fuk T A 8: 110,889,072 T542S probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gdf10 T C 14: 33,934,389 I436T probably damaging Het
Gfod1 T C 13: 43,303,470 T10A possibly damaging Het
Gucy1a1 A G 3: 82,111,151 probably null Het
Heatr5b G T 17: 78,831,444 Q90K probably benign Het
Ikzf3 T A 11: 98,485,649 K211* probably null Het
Itgam A C 7: 128,085,577 D373A probably damaging Het
Itpripl2 A G 7: 118,489,884 F484S probably damaging Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Kif16b T C 2: 142,690,580 K1213R probably damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Mmp25 T A 17: 23,631,074 Y504F probably damaging Het
Mtf2 A G 5: 108,080,931 K38E possibly damaging Het
Myh14 A C 7: 44,652,429 probably null Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nfkb1 T C 3: 135,601,479 T562A probably benign Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Pds5a A T 5: 65,650,498 V464E probably damaging Het
Peak1 C T 9: 56,207,212 V452M probably damaging Het
Phf2 T C 13: 48,820,073 Y372C unknown Het
Poc1a T A 9: 106,285,574 probably null Het
Prss33 C T 17: 23,834,843 V87M probably damaging Het
Psmc2 C G 5: 21,803,129 L344V possibly damaging Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Rabgap1 T C 2: 37,475,441 V242A probably damaging Het
Rad1 C A 15: 10,486,635 H39Q possibly damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Samd9l C T 6: 3,372,945 D1439N possibly damaging Het
Sbno1 A T 5: 124,378,511 D1266E probably benign Het
Sidt2 T C 9: 45,945,340 D477G probably damaging Het
Slc22a13 T C 9: 119,208,687 K125R probably benign Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Smg1 A T 7: 118,158,076 probably benign Het
Spinkl A T 18: 44,169,127 N32K probably benign Het
Stxbp1 T A 2: 32,802,856 I383F probably damaging Het
Taf3 C T 2: 9,951,566 E597K possibly damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tmco6 T C 18: 36,741,687 V409A probably benign Het
Tstd2 T C 4: 46,129,235 T198A probably damaging Het
Vmn1r230 T A 17: 20,846,801 M84K probably damaging Het
Vmn1r45 T A 6: 89,933,983 S2C possibly damaging Het
Vmn2r25 T A 6: 123,839,846 T259S probably benign Het
Vmn2r70 A G 7: 85,563,715 S495P possibly damaging Het
Vmn2r97 A T 17: 18,947,322 R613* probably null Het
Yme1l1 T C 2: 23,162,508 L58P probably damaging Het
Zan G A 5: 137,414,249 probably benign Het
Zfhx4 A G 3: 5,401,741 T2320A possibly damaging Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Other mutations in Cant1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02927:Cant1 APN 11 118411062 missense probably benign 0.01
IGL02989:Cant1 APN 11 118411212 missense probably damaging 1.00
R0512:Cant1 UTSW 11 118411265 missense probably benign 0.26
R0535:Cant1 UTSW 11 118411143 missense probably damaging 1.00
R1953:Cant1 UTSW 11 118408783 missense probably damaging 1.00
R2187:Cant1 UTSW 11 118408841 nonsense probably null
R3916:Cant1 UTSW 11 118408746 missense probably damaging 0.98
R4065:Cant1 UTSW 11 118407997 missense probably benign
R4786:Cant1 UTSW 11 118408839 missense possibly damaging 0.68
R4847:Cant1 UTSW 11 118410110 nonsense probably null
R5093:Cant1 UTSW 11 118411212 missense probably damaging 1.00
R5265:Cant1 UTSW 11 118408050 missense probably damaging 1.00
R5281:Cant1 UTSW 11 118408870 missense probably damaging 0.99
R5506:Cant1 UTSW 11 118411442 missense probably benign 0.10
R5614:Cant1 UTSW 11 118408743 missense probably benign
R6705:Cant1 UTSW 11 118407872 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAATTGTGCGCATTGTGG -3'
(R):5'- CTTCATCTGACTACCTGCTGGG -3'

Sequencing Primer
(F):5'- TGCGCATTGTGGGTGGG -3'
(R):5'- TTCAGCCAGGACTGCACTG -3'
Posted On2014-10-01