Incidental Mutation 'R0196:Tomm70a'
ID23468
Institutional Source Beutler Lab
Gene Symbol Tomm70a
Ensembl Gene ENSMUSG00000022752
Gene Nametranslocase of outer mitochondrial membrane 70A
SynonymsTomm70a, D16Wsu109e, D16Ium22e, Tom70, 2610044B22Rik, D16Ium22
MMRRC Submission 038455-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R0196 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location57121703-57156705 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57146100 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 472 (I472T)
Ref Sequence ENSEMBL: ENSMUSP00000129186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166897]
Predicted Effect probably benign
Transcript: ENSMUST00000166897
AA Change: I472T

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000129186
Gene: ENSMUSG00000022752
AA Change: I472T

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 45 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 98 108 N/A INTRINSIC
TPR 117 150 1.04e-7 SMART
TPR 156 189 1.97e-3 SMART
TPR 190 223 1.6e1 SMART
low complexity region 278 291 N/A INTRINSIC
TPR 332 365 1.17e1 SMART
TPR 370 403 3.5e0 SMART
TPR 404 437 3.32e-1 SMART
TPR 445 478 7.49e1 SMART
TPR 479 512 9.39e-1 SMART
TPR 513 547 9.48e1 SMART
TPR 548 581 4.03e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231298
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 81.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an import receptor of the outer mitochondrial membrane that is part of the translocase of the outer membrane complex. This protein is involved in the import of mitochondrial precursor proteins. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,616,247 probably benign Het
Aass G A 6: 23,109,520 P317L probably damaging Het
Abca12 T A 1: 71,259,813 N2313I possibly damaging Het
Adamts12 T C 15: 11,071,508 I46T probably benign Het
Adipoq T G 16: 23,146,643 probably null Het
Amy1 A T 3: 113,569,421 D92E probably benign Het
Asb15 G A 6: 24,564,393 R282Q probably damaging Het
Bag6 G C 17: 35,144,263 G693A probably damaging Het
Birc6 T C 17: 74,580,287 I870T possibly damaging Het
Cand2 A G 6: 115,789,502 K356R probably damaging Het
Cbfa2t3 T C 8: 122,633,337 Q525R possibly damaging Het
Ccdc94 C A 17: 55,964,653 D191E probably damaging Het
Cd4 T C 6: 124,867,806 R339G probably damaging Het
Cdh8 A G 8: 99,190,434 S350P probably damaging Het
Cep295 A T 9: 15,338,213 S469T probably damaging Het
Ckap2l A T 2: 129,285,422 S279T probably benign Het
Clnk T A 5: 38,769,939 N66Y probably damaging Het
Col27a1 A T 4: 63,224,266 T64S probably benign Het
Crtc1 T C 8: 70,386,221 D599G probably damaging Het
Cyp2c23 A C 19: 44,012,356 I363S probably damaging Het
Dnah10 A T 5: 124,834,075 I4519F possibly damaging Het
Dner T A 1: 84,370,832 I716F probably damaging Het
Dsel T G 1: 111,861,603 T401P possibly damaging Het
Egfr A G 11: 16,911,746 D1175G probably benign Het
Ephb3 A T 16: 21,218,054 N343I probably damaging Het
Fbxw10 T A 11: 62,877,244 F974I probably benign Het
Gfi1b T C 2: 28,613,774 Y138C probably damaging Het
Gm11168 T A 9: 3,005,175 L6H probably benign Het
Grb10 A C 11: 11,945,583 V247G probably damaging Het
Gstp2 A T 19: 4,040,514 probably null Het
Hars2 C T 18: 36,789,204 Q291* probably null Het
Hyal4 G T 6: 24,756,221 W146L probably damaging Het
Il22ra1 C T 4: 135,734,245 T107I possibly damaging Het
Itga8 A G 2: 12,204,729 probably null Het
Klhl25 T C 7: 75,865,702 S119P probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lrrc8c T C 5: 105,606,770 V137A probably benign Het
Macrod2 A T 2: 142,176,625 E226V probably damaging Het
Mcemp1 A T 8: 3,668,201 Q165L probably benign Het
Mcpt9 T A 14: 56,027,996 K82M probably benign Het
Mpzl3 A G 9: 45,062,160 T66A probably damaging Het
Msh6 G A 17: 87,980,360 V143I possibly damaging Het
Mug1 G A 6: 121,838,725 probably null Het
Ncr1 G T 7: 4,340,973 C153F probably damaging Het
Nf1 T A 11: 79,468,769 M1411K possibly damaging Het
Nf1 T A 11: 79,578,272 V786D probably damaging Het
Nisch T C 14: 31,203,394 probably benign Het
Nwd2 T A 5: 63,806,351 Y1093N probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr392 A T 11: 73,814,905 M59K probably damaging Het
Oxa1l T C 14: 54,363,487 I139T probably damaging Het
P3h3 T A 6: 124,845,272 N583Y probably damaging Het
Pcdh18 A T 3: 49,756,698 probably null Het
Pcnp C T 16: 56,024,533 probably benign Het
Pdzd8 G T 19: 59,301,131 D612E probably benign Het
Pi4kb T C 3: 94,998,950 S8P probably damaging Het
Pikfyve T G 1: 65,256,072 V1454G possibly damaging Het
Podn T C 4: 108,021,498 N246D probably damaging Het
Prg4 T C 1: 150,454,492 probably benign Het
R3hdm2 T C 10: 127,484,521 Y523H probably damaging Het
Rpf1 T A 3: 146,508,149 E231V possibly damaging Het
Slc16a10 C T 10: 40,056,615 E317K probably benign Het
Slc34a1 A T 13: 55,412,265 I435F probably damaging Het
Snx19 A G 9: 30,433,387 D629G probably damaging Het
Trp53 A G 11: 69,588,680 Y202C probably damaging Het
Ttc14 T A 3: 33,809,254 probably benign Het
Ugt1a1 C T 1: 88,212,555 A185V possibly damaging Het
Usp28 A G 9: 49,028,278 D655G probably damaging Het
Vmn1r215 C T 13: 23,076,084 T98I probably damaging Het
Vmn2r121 G T X: 124,132,182 T426N probably benign Het
Vmn2r99 A G 17: 19,394,573 N852D probably benign Het
Xrn2 T A 2: 147,047,660 D654E probably damaging Het
Zfp335 C G 2: 164,896,145 A849P possibly damaging Het
Zfp954 C T 7: 7,115,391 V385M probably damaging Het
Zmynd15 A G 11: 70,464,226 T350A probably damaging Het
Other mutations in Tomm70a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Tomm70a APN 16 57149810 splice site probably benign
IGL01064:Tomm70a APN 16 57152612 missense probably damaging 0.99
IGL01597:Tomm70a APN 16 57133188 missense probably benign 0.00
IGL02248:Tomm70a APN 16 57138102 missense probably benign 0.33
IGL02560:Tomm70a APN 16 57149849 missense probably benign 0.33
IGL03328:Tomm70a APN 16 57144787 missense probably damaging 0.99
IGL03335:Tomm70a APN 16 57149926 missense probably damaging 1.00
R0164:Tomm70a UTSW 16 57147821 missense probably damaging 0.96
R0164:Tomm70a UTSW 16 57147821 missense probably damaging 0.96
R0417:Tomm70a UTSW 16 57149903 missense probably benign 0.28
R0763:Tomm70a UTSW 16 57122172 missense probably benign 0.30
R1099:Tomm70a UTSW 16 57142817 missense probably damaging 1.00
R1680:Tomm70a UTSW 16 57121961 missense unknown
R2081:Tomm70a UTSW 16 57140758 missense probably damaging 0.99
R2127:Tomm70a UTSW 16 57121871 missense unknown
R3033:Tomm70a UTSW 16 57122025 missense probably damaging 1.00
R4287:Tomm70a UTSW 16 57140622 missense probably damaging 1.00
R5029:Tomm70a UTSW 16 57122151 missense probably benign
R5210:Tomm70a UTSW 16 57133251 critical splice donor site probably null
R5214:Tomm70a UTSW 16 57121937 missense unknown
R5586:Tomm70a UTSW 16 57122130 missense probably damaging 1.00
R5744:Tomm70a UTSW 16 57121839 start gained probably benign
R5872:Tomm70a UTSW 16 57144742 missense probably benign 0.06
R6256:Tomm70a UTSW 16 57152692 missense probably benign 0.05
R6699:Tomm70a UTSW 16 57142802 missense probably benign 0.02
R6902:Tomm70a UTSW 16 57138081 missense probably damaging 0.96
R7106:Tomm70a UTSW 16 57140758 missense probably damaging 0.99
R7378:Tomm70a UTSW 16 57146044 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTAGGTAATCGGCTCTTCTGAAAATGC -3'
(R):5'- GGAGTCTAGCAAAGCTGGCAAAACTTTA -3'

Sequencing Primer
(F):5'- agcgggtaagagcactaac -3'
(R):5'- aatgtcagccaaacttacacag -3'
Posted On2013-04-16