Incidental Mutation 'R2155:Gm6614'
ID234709
Institutional Source Beutler Lab
Gene Symbol Gm6614
Ensembl Gene ENSMUSG00000079263
Gene Namepredicted gene 6614
Synonyms
MMRRC Submission 040158-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R2155 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location141971845-142011414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141980944 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 552 (D552G)
Ref Sequence ENSEMBL: ENSMUSP00000137696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111832] [ENSMUST00000181628] [ENSMUST00000181791]
Predicted Effect probably damaging
Transcript: ENSMUST00000111832
AA Change: D552G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107463
Gene: ENSMUSG00000079263
AA Change: D552G

DomainStartEndE-ValueType
Pfam:OATP 1 577 2.5e-156 PFAM
Pfam:MFS_1 125 402 1e-23 PFAM
Pfam:Kazal_2 425 466 4.1e-9 PFAM
transmembrane domain 580 602 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158991
Predicted Effect probably damaging
Transcript: ENSMUST00000181628
AA Change: D572G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137967
Gene: ENSMUSG00000079263
AA Change: D572G

DomainStartEndE-ValueType
Pfam:OATP 19 598 2.8e-187 PFAM
Pfam:MFS_1 145 422 8e-24 PFAM
Pfam:Kazal_2 445 486 1.1e-7 PFAM
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000181791
AA Change: D552G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137696
Gene: ENSMUSG00000079263
AA Change: D552G

DomainStartEndE-ValueType
Pfam:OATP 1 578 2.3e-186 PFAM
Pfam:MFS_1 125 402 8.6e-24 PFAM
Pfam:Kazal_2 425 466 1.4e-7 PFAM
transmembrane domain 580 602 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A G 16: 17,121,396 L41P probably damaging Het
Aff4 C T 11: 53,399,619 L469F probably damaging Het
AI182371 G A 2: 35,085,354 H288Y probably benign Het
AK157302 A T 13: 21,495,657 K118* probably null Het
Arhgef2 G A 3: 88,636,044 R454Q probably damaging Het
Asb17 C T 3: 153,844,685 T118M probably damaging Het
Atp7b A G 8: 22,013,584 V718A possibly damaging Het
BC003331 A G 1: 150,382,335 V183A possibly damaging Het
Cdca2 A G 14: 67,714,838 L28S probably damaging Het
Cdh7 G T 1: 110,048,864 L86F probably damaging Het
Cela2a A T 4: 141,818,039 probably null Het
Cers3 T A 7: 66,783,414 Y160N probably damaging Het
Chmp2b A G 16: 65,546,991 V56A probably benign Het
Cryl1 A G 14: 57,398,423 V9A unknown Het
Dmbt1 A T 7: 131,097,575 H978L possibly damaging Het
Dnm1 C T 2: 32,314,937 V673M probably damaging Het
Dtx4 T A 19: 12,485,282 K378* probably null Het
Extl1 A T 4: 134,363,180 M328K possibly damaging Het
Fcgbp T C 7: 28,107,203 S2199P probably benign Het
Glis3 G T 19: 28,531,302 N427K probably benign Het
Gm884 T C 11: 103,620,459 T228A unknown Het
Hdac7 T C 15: 97,794,063 K810E probably benign Het
Hesx1 A G 14: 27,001,477 E88G probably benign Het
Hmcn2 A T 2: 31,460,349 Q5086L possibly damaging Het
Ier3 A G 17: 35,822,209 T128A probably benign Het
Igsf10 G T 3: 59,331,680 T360K probably damaging Het
Ilkap A C 1: 91,384,623 C2G possibly damaging Het
Itih1 A G 14: 30,938,071 F231S probably damaging Het
Jrkl A T 9: 13,244,908 Y249* probably null Het
Kat6a AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 8: 22,935,647 probably benign Het
Katnal2 A T 18: 77,010,941 S184R probably benign Het
Kcnh5 T A 12: 74,898,456 probably null Het
Kcnj11 G T 7: 46,099,357 L181I probably damaging Het
Klhl2 T C 8: 64,749,770 T465A probably benign Het
Krt90 T A 15: 101,562,611 Y72F probably benign Het
Lig4 G A 8: 9,972,766 T338I probably benign Het
Magel2 T C 7: 62,380,792 V1148A unknown Het
Mak C A 13: 41,032,544 E549D probably benign Het
Marf1 G T 16: 14,132,429 S1001Y probably damaging Het
Mcoln1 G A 8: 3,511,787 V446I probably damaging Het
Meig1 T C 2: 3,409,253 N70S probably benign Het
Mfsd14a G A 3: 116,647,830 T108I probably damaging Het
Mocs1 G A 17: 49,454,358 M493I probably damaging Het
Mrpl11 C A 19: 4,962,469 A26E probably damaging Het
Myh6 A T 14: 54,953,794 D863E probably benign Het
Myom2 T A 8: 15,084,555 Y453N probably damaging Het
Nhlh1 A G 1: 172,053,957 I114T probably damaging Het
Olfr131 G T 17: 38,082,180 P266Q probably damaging Het
Olfr181 G T 16: 58,926,123 F149L probably benign Het
Olfr508 C G 7: 108,630,777 P262A probably damaging Het
Olfr533 A C 7: 140,466,591 H130P probably benign Het
Olfr729 A T 14: 50,148,697 M59K probably damaging Het
Pclo T C 5: 14,714,295 S976P probably benign Het
Pde3a G A 6: 141,483,914 E734K possibly damaging Het
Pdzd2 A T 15: 12,375,793 S1419T probably benign Het
Pdzd8 T A 19: 59,300,421 Y849F probably damaging Het
Phldb3 A G 7: 24,612,645 E128G probably damaging Het
Polg A G 7: 79,461,720 I261T possibly damaging Het
Ppp1r35 T C 5: 137,780,005 M254T probably benign Het
Ppp3ca G T 3: 136,890,450 R292M possibly damaging Het
Ptk7 T A 17: 46,579,617 T430S probably benign Het
Ptrh1 T A 2: 32,777,028 N144K possibly damaging Het
Rbfox1 A G 16: 7,294,082 T211A possibly damaging Het
Rbpjl A G 2: 164,414,423 D443G possibly damaging Het
Rcc1 A G 4: 132,338,049 probably null Het
Rimbp2 G T 5: 128,788,165 S706R probably damaging Het
Rsph10b G C 5: 143,961,256 E96D probably benign Het
Scn10a A T 9: 119,609,448 I1784K probably benign Het
Sfxn2 A G 19: 46,591,546 probably null Het
Slamf6 T A 1: 171,938,008 L233Q probably damaging Het
Slc17a5 A T 9: 78,577,173 Y102N probably damaging Het
Slc25a53 T C X: 136,983,467 T42A probably damaging Het
Smg7 G A 1: 152,840,313 T1057I possibly damaging Het
Speer2 T A 16: 69,860,597 T53S possibly damaging Het
Srm A C 4: 148,592,491 I100L probably benign Het
Stoml3 A C 3: 53,507,587 N267H probably damaging Het
Thsd7a A C 6: 12,379,633 C931G probably damaging Het
Tlr11 A G 14: 50,360,682 I42V probably benign Het
Tmigd1 T C 11: 76,910,173 V162A probably benign Het
Tmx3 A G 18: 90,510,381 probably null Het
Topors T A 4: 40,262,790 R165W possibly damaging Het
Ttc17 A T 2: 94,366,642 S453R possibly damaging Het
Vmn1r49 G T 6: 90,072,459 T187N probably damaging Het
Zbtb49 A T 5: 38,214,120 V139E possibly damaging Het
Zfp11 T C 5: 129,657,152 H415R probably damaging Het
Zfp677 A T 17: 21,397,708 K342N probably benign Het
Zfp979 A C 4: 147,613,458 C265G possibly damaging Het
Zfpl1 T C 19: 6,084,429 R9G probably damaging Het
Zkscan8 A T 13: 21,520,589 C321* probably null Het
Other mutations in Gm6614
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01354:Gm6614 APN 6 141990408 missense probably benign 0.00
IGL01548:Gm6614 APN 6 141992512 missense possibly damaging 0.82
IGL01552:Gm6614 APN 6 141987706 missense possibly damaging 0.54
IGL02207:Gm6614 APN 6 141990432 missense possibly damaging 0.80
IGL02227:Gm6614 APN 6 141993675 nonsense probably null
IGL02547:Gm6614 APN 6 141990390 missense probably damaging 0.99
IGL02678:Gm6614 APN 6 142008718 missense probably damaging 1.00
IGL02695:Gm6614 APN 6 141987760 missense probably damaging 1.00
IGL02851:Gm6614 APN 6 142003471 missense probably damaging 1.00
IGL02881:Gm6614 APN 6 141972243 missense probably benign 0.00
IGL02898:Gm6614 APN 6 141994297 missense probably benign 0.01
IGL03036:Gm6614 APN 6 142008607 missense possibly damaging 0.69
IGL03065:Gm6614 APN 6 141992502 missense probably damaging 0.99
IGL03300:Gm6614 APN 6 141994806 missense probably damaging 0.96
R0020:Gm6614 UTSW 6 141972350 missense possibly damaging 0.93
R0020:Gm6614 UTSW 6 141972350 missense possibly damaging 0.93
R0049:Gm6614 UTSW 6 141990421 missense probably benign
R0049:Gm6614 UTSW 6 141990421 missense probably benign
R0149:Gm6614 UTSW 6 141992477 missense probably benign 0.01
R0270:Gm6614 UTSW 6 141972411 missense possibly damaging 0.88
R0360:Gm6614 UTSW 6 141982327 splice site probably benign
R0420:Gm6614 UTSW 6 141985477 splice site probably benign
R0737:Gm6614 UTSW 6 142003428 missense possibly damaging 0.79
R1344:Gm6614 UTSW 6 141985618 missense probably damaging 1.00
R1464:Gm6614 UTSW 6 141992517 nonsense probably null
R1464:Gm6614 UTSW 6 141992517 nonsense probably null
R1590:Gm6614 UTSW 6 141980872 missense probably benign 0.00
R1666:Gm6614 UTSW 6 141982049 splice site probably null
R1669:Gm6614 UTSW 6 141987689 missense probably benign 0.39
R1862:Gm6614 UTSW 6 142003423 missense possibly damaging 0.95
R1882:Gm6614 UTSW 6 141993637 critical splice donor site probably null
R2134:Gm6614 UTSW 6 141980978 missense probably damaging 1.00
R2163:Gm6614 UTSW 6 141980938 missense possibly damaging 0.55
R2227:Gm6614 UTSW 6 141992361 missense possibly damaging 0.67
R2382:Gm6614 UTSW 6 141990480 missense probably benign 0.00
R3773:Gm6614 UTSW 6 141972335 missense probably benign 0.17
R4869:Gm6614 UTSW 6 141987766 missense probably damaging 1.00
R4975:Gm6614 UTSW 6 141980873 missense probably benign 0.30
R5061:Gm6614 UTSW 6 142008688 missense probably benign 0.03
R5079:Gm6614 UTSW 6 141972347 missense probably benign 0.00
R5312:Gm6614 UTSW 6 141972332 missense probably benign 0.00
R5691:Gm6614 UTSW 6 141994855 nonsense probably null
R5874:Gm6614 UTSW 6 141972235 missense probably benign 0.00
R5945:Gm6614 UTSW 6 141994282 missense probably damaging 1.00
R6478:Gm6614 UTSW 6 141993642 missense possibly damaging 0.93
R7305:Gm6614 UTSW 6 141992494 missense probably damaging 1.00
R7325:Gm6614 UTSW 6 141989225 missense probably damaging 0.98
R7427:Gm6614 UTSW 6 142003508 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTCAAGACAAGGCTTTATATGAAAGGG -3'
(R):5'- TACGCACAGCTTTCATTTGTTG -3'

Sequencing Primer
(F):5'- CTTTATATGAAAGGGGATGCCTCAG -3'
(R):5'- TTTCCTAAAAGTAAGCTGTGAGC -3'
Posted On2014-10-01