Incidental Mutation 'R2155:Dmbt1'
ID 234721
Institutional Source Beutler Lab
Gene Symbol Dmbt1
Ensembl Gene ENSMUSG00000047517
Gene Name deleted in malignant brain tumors 1
Synonyms Crpd, gp300, hensin, CRP-[b], MUCLIN, ebnerin, CRP-[a], vomeroglandin
MMRRC Submission 040158-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.187) question?
Stock # R2155 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 130633787-130723357 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 130699305 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 978 (H978L)
Ref Sequence ENSEMBL: ENSMUSP00000148657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000084509
AA Change: H1141L
SMART Domains Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: H1141L

DomainStartEndE-ValueType
SR 37 137 5.54e-59 SMART
SR 186 286 3.6e-58 SMART
SR 324 424 1.21e-59 SMART
SR 463 563 2.97e-59 SMART
SR 602 702 3.36e-58 SMART
SR 741 841 5.17e-59 SMART
low complexity region 848 879 N/A INTRINSIC
CUB 884 993 4.22e-41 SMART
CUB 1000 1109 7.35e-41 SMART
CUB 1126 1235 3.73e-42 SMART
CUB 1242 1351 2.02e-38 SMART
SR 1371 1471 3.92e-59 SMART
low complexity region 1476 1488 N/A INTRINSIC
CUB 1494 1603 6.7e-44 SMART
ZP 1612 1860 8.11e-74 SMART
transmembrane domain 1906 1928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208311
AA Change: H1152L
Predicted Effect possibly damaging
Transcript: ENSMUST00000213064
AA Change: H978L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A G 16: 16,939,260 (GRCm39) L41P probably damaging Het
Aff4 C T 11: 53,290,446 (GRCm39) L469F probably damaging Het
AI182371 G A 2: 34,975,366 (GRCm39) H288Y probably benign Het
AK157302 A T 13: 21,679,827 (GRCm39) K118* probably null Het
Arhgef2 G A 3: 88,543,351 (GRCm39) R454Q probably damaging Het
Asb17 C T 3: 153,550,322 (GRCm39) T118M probably damaging Het
Atp7b A G 8: 22,503,600 (GRCm39) V718A possibly damaging Het
Cdca2 A G 14: 67,952,287 (GRCm39) L28S probably damaging Het
Cdh20 G T 1: 109,976,594 (GRCm39) L86F probably damaging Het
Cela2a A T 4: 141,545,350 (GRCm39) probably null Het
Cers3 T A 7: 66,433,162 (GRCm39) Y160N probably damaging Het
Chmp2b A G 16: 65,343,877 (GRCm39) V56A probably benign Het
Cryl1 A G 14: 57,635,880 (GRCm39) V9A unknown Het
Dnm1 C T 2: 32,204,949 (GRCm39) V673M probably damaging Het
Dtx4 T A 19: 12,462,646 (GRCm39) K378* probably null Het
Extl1 A T 4: 134,090,491 (GRCm39) M328K possibly damaging Het
Fcgbp T C 7: 27,806,628 (GRCm39) S2199P probably benign Het
Glis3 G T 19: 28,508,702 (GRCm39) N427K probably benign Het
Hdac7 T C 15: 97,691,944 (GRCm39) K810E probably benign Het
Hesx1 A G 14: 26,723,434 (GRCm39) E88G probably benign Het
Hmcn2 A T 2: 31,350,361 (GRCm39) Q5086L possibly damaging Het
Ier3 A G 17: 36,133,101 (GRCm39) T128A probably benign Het
Igsf10 G T 3: 59,239,101 (GRCm39) T360K probably damaging Het
Ilkap A C 1: 91,312,345 (GRCm39) C2G possibly damaging Het
Itih1 A G 14: 30,660,028 (GRCm39) F231S probably damaging Het
Jrkl A T 9: 13,244,913 (GRCm39) Y249* probably null Het
Kat6a AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 8: 23,425,663 (GRCm39) probably benign Het
Katnal2 A T 18: 77,098,637 (GRCm39) S184R probably benign Het
Kcnh5 T A 12: 74,945,230 (GRCm39) probably null Het
Kcnj11 G T 7: 45,748,781 (GRCm39) L181I probably damaging Het
Klhl2 T C 8: 65,202,804 (GRCm39) T465A probably benign Het
Krt90 T A 15: 101,471,046 (GRCm39) Y72F probably benign Het
Lig4 G A 8: 10,022,766 (GRCm39) T338I probably benign Het
Lrrc37 T C 11: 103,511,285 (GRCm39) T228A unknown Het
Magel2 T C 7: 62,030,540 (GRCm39) V1148A unknown Het
Mak C A 13: 41,186,020 (GRCm39) E549D probably benign Het
Marf1 G T 16: 13,950,293 (GRCm39) S1001Y probably damaging Het
Mcoln1 G A 8: 3,561,787 (GRCm39) V446I probably damaging Het
Meig1 T C 2: 3,410,290 (GRCm39) N70S probably benign Het
Mfsd14a G A 3: 116,441,479 (GRCm39) T108I probably damaging Het
Mocs1 G A 17: 49,761,386 (GRCm39) M493I probably damaging Het
Mrpl11 C A 19: 5,012,497 (GRCm39) A26E probably damaging Het
Myh6 A T 14: 55,191,251 (GRCm39) D863E probably benign Het
Myom2 T A 8: 15,134,555 (GRCm39) Y453N probably damaging Het
Nhlh1 A G 1: 171,881,524 (GRCm39) I114T probably damaging Het
Odr4 A G 1: 150,258,086 (GRCm39) V183A possibly damaging Het
Or12j4 A C 7: 140,046,504 (GRCm39) H130P probably benign Het
Or2y3 G T 17: 38,393,071 (GRCm39) P266Q probably damaging Het
Or4k5 A T 14: 50,386,154 (GRCm39) M59K probably damaging Het
Or5k17 G T 16: 58,746,486 (GRCm39) F149L probably benign Het
Or5p80 C G 7: 108,229,984 (GRCm39) P262A probably damaging Het
Pclo T C 5: 14,764,309 (GRCm39) S976P probably benign Het
Pde3a G A 6: 141,429,640 (GRCm39) E734K possibly damaging Het
Pdzd2 A T 15: 12,375,879 (GRCm39) S1419T probably benign Het
Pdzd8 T A 19: 59,288,853 (GRCm39) Y849F probably damaging Het
Phldb3 A G 7: 24,312,070 (GRCm39) E128G probably damaging Het
Polg A G 7: 79,111,468 (GRCm39) I261T possibly damaging Het
Ppp1r35 T C 5: 137,778,267 (GRCm39) M254T probably benign Het
Ppp3ca G T 3: 136,596,211 (GRCm39) R292M possibly damaging Het
Ptk7 T A 17: 46,890,543 (GRCm39) T430S probably benign Het
Ptrh1 T A 2: 32,667,040 (GRCm39) N144K possibly damaging Het
Rbfox1 A G 16: 7,111,946 (GRCm39) T211A possibly damaging Het
Rbpjl A G 2: 164,256,343 (GRCm39) D443G possibly damaging Het
Rcc1 A G 4: 132,065,360 (GRCm39) probably null Het
Rimbp2 G T 5: 128,865,229 (GRCm39) S706R probably damaging Het
Rsph10b G C 5: 143,898,074 (GRCm39) E96D probably benign Het
Scn10a A T 9: 119,438,514 (GRCm39) I1784K probably benign Het
Sfxn2 A G 19: 46,579,985 (GRCm39) probably null Het
Slamf6 T A 1: 171,765,575 (GRCm39) L233Q probably damaging Het
Slc17a5 A T 9: 78,484,455 (GRCm39) Y102N probably damaging Het
Slc25a53 T C X: 135,884,216 (GRCm39) T42A probably damaging Het
Slco1a8 T C 6: 141,926,670 (GRCm39) D552G probably damaging Het
Smg7 G A 1: 152,716,064 (GRCm39) T1057I possibly damaging Het
Speer2 T A 16: 69,657,485 (GRCm39) T53S possibly damaging Het
Srm A C 4: 148,676,948 (GRCm39) I100L probably benign Het
Stoml3 A C 3: 53,415,008 (GRCm39) N267H probably damaging Het
Thsd7a A C 6: 12,379,632 (GRCm39) C931G probably damaging Het
Tlr11 A G 14: 50,598,139 (GRCm39) I42V probably benign Het
Tmigd1 T C 11: 76,800,999 (GRCm39) V162A probably benign Het
Tmx3 A G 18: 90,528,505 (GRCm39) probably null Het
Topors T A 4: 40,262,790 (GRCm39) R165W possibly damaging Het
Ttc17 A T 2: 94,196,987 (GRCm39) S453R possibly damaging Het
Vmn1r49 G T 6: 90,049,441 (GRCm39) T187N probably damaging Het
Zbtb49 A T 5: 38,371,464 (GRCm39) V139E possibly damaging Het
Zfp11 T C 5: 129,734,216 (GRCm39) H415R probably damaging Het
Zfp677 A T 17: 21,617,970 (GRCm39) K342N probably benign Het
Zfp979 A C 4: 147,697,915 (GRCm39) C265G possibly damaging Het
Zfpl1 T C 19: 6,134,459 (GRCm39) R9G probably damaging Het
Zkscan8 A T 13: 21,704,759 (GRCm39) C321* probably null Het
Other mutations in Dmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dmbt1 APN 7 130,681,270 (GRCm39) intron probably benign
IGL00161:Dmbt1 APN 7 130,711,357 (GRCm39) missense probably damaging 1.00
IGL00331:Dmbt1 APN 7 130,701,020 (GRCm39) missense possibly damaging 0.46
IGL00769:Dmbt1 APN 7 130,684,230 (GRCm39) missense probably damaging 0.99
IGL00792:Dmbt1 APN 7 130,699,337 (GRCm39) missense possibly damaging 0.66
IGL00823:Dmbt1 APN 7 130,659,888 (GRCm39) missense probably benign 0.26
IGL01072:Dmbt1 APN 7 130,687,098 (GRCm39) splice site probably benign
IGL01317:Dmbt1 APN 7 130,642,921 (GRCm39) missense probably damaging 1.00
IGL01335:Dmbt1 APN 7 130,690,497 (GRCm39) missense possibly damaging 0.95
IGL01372:Dmbt1 APN 7 130,705,409 (GRCm39) missense possibly damaging 0.90
IGL01511:Dmbt1 APN 7 130,718,457 (GRCm39) missense possibly damaging 0.49
IGL01627:Dmbt1 APN 7 130,682,915 (GRCm39) missense probably benign 0.14
IGL01890:Dmbt1 APN 7 130,676,149 (GRCm39) intron probably benign
IGL02160:Dmbt1 APN 7 130,684,418 (GRCm39) missense probably damaging 1.00
IGL02186:Dmbt1 APN 7 130,694,986 (GRCm39) splice site probably benign
IGL02197:Dmbt1 APN 7 130,687,152 (GRCm39) splice site probably benign
IGL02332:Dmbt1 APN 7 130,668,343 (GRCm39) intron probably benign
IGL02427:Dmbt1 APN 7 130,689,815 (GRCm39) splice site probably null
IGL02726:Dmbt1 APN 7 130,676,140 (GRCm39) intron probably benign
IGL02967:Dmbt1 APN 7 130,672,919 (GRCm39) missense possibly damaging 0.70
IGL03003:Dmbt1 APN 7 130,684,409 (GRCm39) missense probably benign 0.05
IGL03089:Dmbt1 APN 7 130,712,778 (GRCm39) missense probably damaging 0.99
cavity UTSW 7 130,713,965 (GRCm39) missense unknown
lacunar UTSW 7 130,699,361 (GRCm39) missense probably damaging 0.97
BB005:Dmbt1 UTSW 7 130,639,620 (GRCm39) missense probably benign 0.16
BB015:Dmbt1 UTSW 7 130,639,620 (GRCm39) missense probably benign 0.16
H8562:Dmbt1 UTSW 7 130,713,805 (GRCm39) nonsense probably null
K3955:Dmbt1 UTSW 7 130,721,293 (GRCm39) missense probably damaging 0.98
R0051:Dmbt1 UTSW 7 130,721,225 (GRCm39) missense possibly damaging 0.79
R0051:Dmbt1 UTSW 7 130,721,225 (GRCm39) missense possibly damaging 0.79
R0257:Dmbt1 UTSW 7 130,708,123 (GRCm39) missense probably damaging 1.00
R0388:Dmbt1 UTSW 7 130,697,779 (GRCm39) splice site probably benign
R0427:Dmbt1 UTSW 7 130,642,632 (GRCm39) nonsense probably null
R0478:Dmbt1 UTSW 7 130,642,917 (GRCm39) missense possibly damaging 0.93
R0502:Dmbt1 UTSW 7 130,699,403 (GRCm39) splice site probably null
R0538:Dmbt1 UTSW 7 130,651,631 (GRCm39) splice site probably benign
R0626:Dmbt1 UTSW 7 130,703,811 (GRCm39) missense probably damaging 0.97
R0631:Dmbt1 UTSW 7 130,699,383 (GRCm39) missense possibly damaging 0.90
R0948:Dmbt1 UTSW 7 130,694,847 (GRCm39) missense possibly damaging 0.95
R1169:Dmbt1 UTSW 7 130,676,254 (GRCm39) critical splice donor site probably null
R1413:Dmbt1 UTSW 7 130,651,944 (GRCm39) missense probably damaging 1.00
R1458:Dmbt1 UTSW 7 130,646,217 (GRCm39) splice site probably benign
R1463:Dmbt1 UTSW 7 130,711,366 (GRCm39) critical splice donor site probably null
R1509:Dmbt1 UTSW 7 130,676,061 (GRCm39) intron probably benign
R1990:Dmbt1 UTSW 7 130,660,018 (GRCm39) missense probably damaging 0.98
R2018:Dmbt1 UTSW 7 130,712,718 (GRCm39) missense possibly damaging 0.93
R2019:Dmbt1 UTSW 7 130,712,718 (GRCm39) missense possibly damaging 0.93
R2042:Dmbt1 UTSW 7 130,708,089 (GRCm39) missense probably damaging 0.99
R2056:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2057:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2058:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2059:Dmbt1 UTSW 7 130,707,900 (GRCm39) missense possibly damaging 0.80
R2061:Dmbt1 UTSW 7 130,700,863 (GRCm39) missense possibly damaging 0.66
R2092:Dmbt1 UTSW 7 130,651,748 (GRCm39) missense probably damaging 1.00
R2102:Dmbt1 UTSW 7 130,703,762 (GRCm39) missense probably damaging 0.97
R2243:Dmbt1 UTSW 7 130,648,292 (GRCm39) missense probably benign 0.03
R2256:Dmbt1 UTSW 7 130,692,224 (GRCm39) missense probably benign 0.01
R2391:Dmbt1 UTSW 7 130,708,198 (GRCm39) missense probably damaging 1.00
R2394:Dmbt1 UTSW 7 130,696,464 (GRCm39) nonsense probably null
R3014:Dmbt1 UTSW 7 130,633,827 (GRCm39) intron probably benign
R3155:Dmbt1 UTSW 7 130,651,887 (GRCm39) nonsense probably null
R3176:Dmbt1 UTSW 7 130,689,801 (GRCm39) missense probably benign 0.19
R3276:Dmbt1 UTSW 7 130,689,801 (GRCm39) missense probably benign 0.19
R3442:Dmbt1 UTSW 7 130,707,979 (GRCm39) missense probably damaging 1.00
R3807:Dmbt1 UTSW 7 130,713,819 (GRCm39) missense possibly damaging 0.77
R4060:Dmbt1 UTSW 7 130,675,932 (GRCm39) intron probably benign
R4396:Dmbt1 UTSW 7 130,718,361 (GRCm39) missense probably damaging 0.98
R4453:Dmbt1 UTSW 7 130,642,664 (GRCm39) missense probably damaging 1.00
R5001:Dmbt1 UTSW 7 130,651,742 (GRCm39) missense probably damaging 1.00
R5051:Dmbt1 UTSW 7 130,696,472 (GRCm39) missense probably benign 0.01
R5156:Dmbt1 UTSW 7 130,699,400 (GRCm39) critical splice donor site probably null
R5225:Dmbt1 UTSW 7 130,696,465 (GRCm39) missense possibly damaging 0.84
R5281:Dmbt1 UTSW 7 130,684,349 (GRCm39) missense probably damaging 1.00
R5308:Dmbt1 UTSW 7 130,642,751 (GRCm39) missense probably damaging 1.00
R5447:Dmbt1 UTSW 7 130,721,240 (GRCm39) missense probably damaging 0.99
R5467:Dmbt1 UTSW 7 130,642,723 (GRCm39) missense probably damaging 1.00
R5497:Dmbt1 UTSW 7 130,665,133 (GRCm39) intron probably benign
R5526:Dmbt1 UTSW 7 130,642,920 (GRCm39) missense probably damaging 1.00
R5554:Dmbt1 UTSW 7 130,701,030 (GRCm39) nonsense probably null
R5566:Dmbt1 UTSW 7 130,708,003 (GRCm39) missense probably damaging 1.00
R5595:Dmbt1 UTSW 7 130,655,797 (GRCm39) missense probably benign 0.17
R6154:Dmbt1 UTSW 7 130,711,370 (GRCm39) splice site probably null
R6188:Dmbt1 UTSW 7 130,699,361 (GRCm39) missense probably damaging 0.97
R6214:Dmbt1 UTSW 7 130,668,463 (GRCm39) missense possibly damaging 0.95
R6215:Dmbt1 UTSW 7 130,668,463 (GRCm39) missense possibly damaging 0.95
R6391:Dmbt1 UTSW 7 130,659,984 (GRCm39) missense probably damaging 1.00
R6397:Dmbt1 UTSW 7 130,705,308 (GRCm39) missense possibly damaging 0.46
R6436:Dmbt1 UTSW 7 130,718,370 (GRCm39) missense probably benign 0.01
R6603:Dmbt1 UTSW 7 130,648,240 (GRCm39) splice site probably null
R6719:Dmbt1 UTSW 7 130,721,332 (GRCm39) missense possibly damaging 0.83
R6781:Dmbt1 UTSW 7 130,648,291 (GRCm39) missense probably benign 0.16
R7148:Dmbt1 UTSW 7 130,668,464 (GRCm39) nonsense probably null
R7191:Dmbt1 UTSW 7 130,646,250 (GRCm39) missense unknown
R7269:Dmbt1 UTSW 7 130,668,351 (GRCm39) missense unknown
R7288:Dmbt1 UTSW 7 130,685,519 (GRCm39) nonsense probably null
R7296:Dmbt1 UTSW 7 130,713,861 (GRCm39) missense unknown
R7349:Dmbt1 UTSW 7 130,642,854 (GRCm39) missense unknown
R7386:Dmbt1 UTSW 7 130,713,965 (GRCm39) missense unknown
R7428:Dmbt1 UTSW 7 130,710,192 (GRCm39) missense possibly damaging 0.53
R7481:Dmbt1 UTSW 7 130,681,241 (GRCm39) critical splice acceptor site probably null
R7486:Dmbt1 UTSW 7 130,668,192 (GRCm39) missense unknown
R7513:Dmbt1 UTSW 7 130,692,242 (GRCm39) missense unknown
R7553:Dmbt1 UTSW 7 130,706,597 (GRCm39) missense unknown
R7567:Dmbt1 UTSW 7 130,663,093 (GRCm39) splice site probably null
R7584:Dmbt1 UTSW 7 130,690,481 (GRCm39) nonsense probably null
R7736:Dmbt1 UTSW 7 130,718,625 (GRCm39) missense unknown
R7758:Dmbt1 UTSW 7 130,722,926 (GRCm39) missense unknown
R7928:Dmbt1 UTSW 7 130,639,620 (GRCm39) missense probably benign 0.16
R8080:Dmbt1 UTSW 7 130,690,500 (GRCm39) missense unknown
R8098:Dmbt1 UTSW 7 130,710,188 (GRCm39) nonsense probably null
R8125:Dmbt1 UTSW 7 130,700,953 (GRCm39) missense unknown
R8177:Dmbt1 UTSW 7 130,708,162 (GRCm39) missense possibly damaging 0.46
R8350:Dmbt1 UTSW 7 130,687,147 (GRCm39) critical splice donor site probably null
R8366:Dmbt1 UTSW 7 130,668,330 (GRCm39) missense unknown
R8378:Dmbt1 UTSW 7 130,708,195 (GRCm39) missense probably damaging 0.96
R8399:Dmbt1 UTSW 7 130,684,317 (GRCm39) missense unknown
R8400:Dmbt1 UTSW 7 130,684,317 (GRCm39) missense unknown
R8445:Dmbt1 UTSW 7 130,692,110 (GRCm39) missense unknown
R8450:Dmbt1 UTSW 7 130,687,147 (GRCm39) critical splice donor site probably null
R8511:Dmbt1 UTSW 7 130,703,742 (GRCm39) missense unknown
R8688:Dmbt1 UTSW 7 130,659,984 (GRCm39) missense unknown
R8850:Dmbt1 UTSW 7 130,692,134 (GRCm39) missense unknown
R8852:Dmbt1 UTSW 7 130,642,853 (GRCm39) missense unknown
R8871:Dmbt1 UTSW 7 130,718,597 (GRCm39) missense unknown
R8943:Dmbt1 UTSW 7 130,721,372 (GRCm39) missense possibly damaging 0.68
R8978:Dmbt1 UTSW 7 130,639,611 (GRCm39) missense possibly damaging 0.53
R9004:Dmbt1 UTSW 7 130,713,798 (GRCm39) missense unknown
R9020:Dmbt1 UTSW 7 130,712,787 (GRCm39) missense possibly damaging 0.86
R9088:Dmbt1 UTSW 7 130,718,418 (GRCm39) missense unknown
R9230:Dmbt1 UTSW 7 130,639,642 (GRCm39) missense probably benign 0.01
R9304:Dmbt1 UTSW 7 130,700,855 (GRCm39) missense unknown
R9377:Dmbt1 UTSW 7 130,694,832 (GRCm39) missense unknown
R9428:Dmbt1 UTSW 7 130,668,208 (GRCm39) missense unknown
R9474:Dmbt1 UTSW 7 130,675,987 (GRCm39) missense unknown
R9573:Dmbt1 UTSW 7 130,657,910 (GRCm39) critical splice donor site probably null
R9675:Dmbt1 UTSW 7 130,712,652 (GRCm39) missense probably damaging 0.98
R9689:Dmbt1 UTSW 7 130,660,015 (GRCm39) missense unknown
R9781:Dmbt1 UTSW 7 130,639,599 (GRCm39) missense probably benign 0.00
X0024:Dmbt1 UTSW 7 130,713,977 (GRCm39) nonsense probably null
X0062:Dmbt1 UTSW 7 130,696,581 (GRCm39) missense possibly damaging 0.81
Z1176:Dmbt1 UTSW 7 130,690,542 (GRCm39) missense unknown
Z1177:Dmbt1 UTSW 7 130,684,215 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGTCCTCAGAATGTCACCAAGG -3'
(R):5'- TGGAACCTGTATTGTAACTGCC -3'

Sequencing Primer
(F):5'- TGTCACCAAGGCTAGGTTATC -3'
(R):5'- GGAACCTGTATTGTAACTGCCGATTC -3'
Posted On 2014-10-01