Incidental Mutation 'R2155:Aff4'
ID234732
Institutional Source Beutler Lab
Gene Symbol Aff4
Ensembl Gene ENSMUSG00000049470
Gene NameAF4/FMR2 family, member 4
SynonymsLaf4l, Alf4
MMRRC Submission 040158-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2155 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location53350833-53421830 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 53399619 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 469 (L469F)
Ref Sequence ENSEMBL: ENSMUSP00000051479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060945]
Predicted Effect probably damaging
Transcript: ENSMUST00000060945
AA Change: L469F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: L469F

DomainStartEndE-ValueType
Pfam:AF-4 2 1156 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130152
Predicted Effect probably benign
Transcript: ENSMUST00000152616
SMART Domains Protein: ENSMUSP00000118866
Gene: ENSMUSG00000049470

DomainStartEndE-ValueType
Pfam:AF-4 1 51 4e-15 PFAM
Pfam:AF-4 46 159 1.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154499
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A G 16: 17,121,396 L41P probably damaging Het
AI182371 G A 2: 35,085,354 H288Y probably benign Het
AK157302 A T 13: 21,495,657 K118* probably null Het
Arhgef2 G A 3: 88,636,044 R454Q probably damaging Het
Asb17 C T 3: 153,844,685 T118M probably damaging Het
Atp7b A G 8: 22,013,584 V718A possibly damaging Het
BC003331 A G 1: 150,382,335 V183A possibly damaging Het
Cdca2 A G 14: 67,714,838 L28S probably damaging Het
Cdh7 G T 1: 110,048,864 L86F probably damaging Het
Cela2a A T 4: 141,818,039 probably null Het
Cers3 T A 7: 66,783,414 Y160N probably damaging Het
Chmp2b A G 16: 65,546,991 V56A probably benign Het
Cryl1 A G 14: 57,398,423 V9A unknown Het
Dmbt1 A T 7: 131,097,575 H978L possibly damaging Het
Dnm1 C T 2: 32,314,937 V673M probably damaging Het
Dtx4 T A 19: 12,485,282 K378* probably null Het
Extl1 A T 4: 134,363,180 M328K possibly damaging Het
Fcgbp T C 7: 28,107,203 S2199P probably benign Het
Glis3 G T 19: 28,531,302 N427K probably benign Het
Gm6614 T C 6: 141,980,944 D552G probably damaging Het
Gm884 T C 11: 103,620,459 T228A unknown Het
Hdac7 T C 15: 97,794,063 K810E probably benign Het
Hesx1 A G 14: 27,001,477 E88G probably benign Het
Hmcn2 A T 2: 31,460,349 Q5086L possibly damaging Het
Ier3 A G 17: 35,822,209 T128A probably benign Het
Igsf10 G T 3: 59,331,680 T360K probably damaging Het
Ilkap A C 1: 91,384,623 C2G possibly damaging Het
Itih1 A G 14: 30,938,071 F231S probably damaging Het
Jrkl A T 9: 13,244,908 Y249* probably null Het
Kat6a AGAGGAGGAGGAGGAGGAGGAGGAG AGAGGAGGAGGAGGAGGAGGAG 8: 22,935,647 probably benign Het
Katnal2 A T 18: 77,010,941 S184R probably benign Het
Kcnh5 T A 12: 74,898,456 probably null Het
Kcnj11 G T 7: 46,099,357 L181I probably damaging Het
Klhl2 T C 8: 64,749,770 T465A probably benign Het
Krt90 T A 15: 101,562,611 Y72F probably benign Het
Lig4 G A 8: 9,972,766 T338I probably benign Het
Magel2 T C 7: 62,380,792 V1148A unknown Het
Mak C A 13: 41,032,544 E549D probably benign Het
Marf1 G T 16: 14,132,429 S1001Y probably damaging Het
Mcoln1 G A 8: 3,511,787 V446I probably damaging Het
Meig1 T C 2: 3,409,253 N70S probably benign Het
Mfsd14a G A 3: 116,647,830 T108I probably damaging Het
Mocs1 G A 17: 49,454,358 M493I probably damaging Het
Mrpl11 C A 19: 4,962,469 A26E probably damaging Het
Myh6 A T 14: 54,953,794 D863E probably benign Het
Myom2 T A 8: 15,084,555 Y453N probably damaging Het
Nhlh1 A G 1: 172,053,957 I114T probably damaging Het
Olfr131 G T 17: 38,082,180 P266Q probably damaging Het
Olfr181 G T 16: 58,926,123 F149L probably benign Het
Olfr508 C G 7: 108,630,777 P262A probably damaging Het
Olfr533 A C 7: 140,466,591 H130P probably benign Het
Olfr729 A T 14: 50,148,697 M59K probably damaging Het
Pclo T C 5: 14,714,295 S976P probably benign Het
Pde3a G A 6: 141,483,914 E734K possibly damaging Het
Pdzd2 A T 15: 12,375,793 S1419T probably benign Het
Pdzd8 T A 19: 59,300,421 Y849F probably damaging Het
Phldb3 A G 7: 24,612,645 E128G probably damaging Het
Polg A G 7: 79,461,720 I261T possibly damaging Het
Ppp1r35 T C 5: 137,780,005 M254T probably benign Het
Ppp3ca G T 3: 136,890,450 R292M possibly damaging Het
Ptk7 T A 17: 46,579,617 T430S probably benign Het
Ptrh1 T A 2: 32,777,028 N144K possibly damaging Het
Rbfox1 A G 16: 7,294,082 T211A possibly damaging Het
Rbpjl A G 2: 164,414,423 D443G possibly damaging Het
Rcc1 A G 4: 132,338,049 probably null Het
Rimbp2 G T 5: 128,788,165 S706R probably damaging Het
Rsph10b G C 5: 143,961,256 E96D probably benign Het
Scn10a A T 9: 119,609,448 I1784K probably benign Het
Sfxn2 A G 19: 46,591,546 probably null Het
Slamf6 T A 1: 171,938,008 L233Q probably damaging Het
Slc17a5 A T 9: 78,577,173 Y102N probably damaging Het
Slc25a53 T C X: 136,983,467 T42A probably damaging Het
Smg7 G A 1: 152,840,313 T1057I possibly damaging Het
Speer2 T A 16: 69,860,597 T53S possibly damaging Het
Srm A C 4: 148,592,491 I100L probably benign Het
Stoml3 A C 3: 53,507,587 N267H probably damaging Het
Thsd7a A C 6: 12,379,633 C931G probably damaging Het
Tlr11 A G 14: 50,360,682 I42V probably benign Het
Tmigd1 T C 11: 76,910,173 V162A probably benign Het
Tmx3 A G 18: 90,510,381 probably null Het
Topors T A 4: 40,262,790 R165W possibly damaging Het
Ttc17 A T 2: 94,366,642 S453R possibly damaging Het
Vmn1r49 G T 6: 90,072,459 T187N probably damaging Het
Zbtb49 A T 5: 38,214,120 V139E possibly damaging Het
Zfp11 T C 5: 129,657,152 H415R probably damaging Het
Zfp677 A T 17: 21,397,708 K342N probably benign Het
Zfp979 A C 4: 147,613,458 C265G possibly damaging Het
Zfpl1 T C 19: 6,084,429 R9G probably damaging Het
Zkscan8 A T 13: 21,520,589 C321* probably null Het
Other mutations in Aff4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Aff4 APN 11 53411990 missense probably damaging 0.98
IGL01348:Aff4 APN 11 53402500 missense probably benign
IGL01446:Aff4 APN 11 53415469 missense probably damaging 0.99
IGL02151:Aff4 APN 11 53399806 missense probably benign
IGL02526:Aff4 APN 11 53406682 splice site probably benign
IGL02567:Aff4 APN 11 53372751 missense possibly damaging 0.64
IGL02633:Aff4 APN 11 53409371 splice site probably benign
IGL02707:Aff4 APN 11 53399740 missense probably benign
R0090:Aff4 UTSW 11 53392782 missense probably benign 0.01
R0128:Aff4 UTSW 11 53415466 missense probably damaging 0.99
R0243:Aff4 UTSW 11 53397858 missense possibly damaging 0.74
R0345:Aff4 UTSW 11 53372881 missense probably benign 0.00
R0347:Aff4 UTSW 11 53400088 missense probably benign 0.01
R0732:Aff4 UTSW 11 53375596 missense probably benign
R0737:Aff4 UTSW 11 53410953 nonsense probably null
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1500:Aff4 UTSW 11 53372378 missense probably benign 0.00
R1693:Aff4 UTSW 11 53396553 missense probably damaging 1.00
R1743:Aff4 UTSW 11 53368695 missense possibly damaging 0.65
R1961:Aff4 UTSW 11 53372999 missense probably damaging 1.00
R2048:Aff4 UTSW 11 53398385 missense probably benign 0.39
R2138:Aff4 UTSW 11 53372512 missense possibly damaging 0.94
R2379:Aff4 UTSW 11 53408478 splice site probably benign
R4156:Aff4 UTSW 11 53410899 intron probably benign
R5001:Aff4 UTSW 11 53404357 missense probably damaging 1.00
R5281:Aff4 UTSW 11 53372288 missense probably damaging 1.00
R5477:Aff4 UTSW 11 53408472 critical splice donor site probably null
R5677:Aff4 UTSW 11 53400275 missense possibly damaging 0.55
R5992:Aff4 UTSW 11 53373010 missense probably damaging 0.99
R6576:Aff4 UTSW 11 53400441 missense probably damaging 1.00
R6764:Aff4 UTSW 11 53399830 missense probably damaging 1.00
R6988:Aff4 UTSW 11 53398237 missense probably damaging 1.00
R7034:Aff4 UTSW 11 53408409 missense probably damaging 0.99
R7177:Aff4 UTSW 11 53406639 missense probably benign 0.10
R7426:Aff4 UTSW 11 53372875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGTTTTGATCCTGGCATAAAC -3'
(R):5'- TCTGTGCAGGAGACTTCTGC -3'

Sequencing Primer
(F):5'- CCTGGCATAAACATGACATATGCTTG -3'
(R):5'- GAGACTTCTGCCTCCCACG -3'
Posted On2014-10-01