Incidental Mutation 'R0197:Espnl'
ID23477
Institutional Source Beutler Lab
Gene Symbol Espnl
Ensembl Gene ENSMUSG00000049515
Gene Nameespin-like
SynonymsLOC227357
MMRRC Submission 038456-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R0197 (G1)
Quality Score167
Status Validated
Chromosome1
Chromosomal Location91322075-91348306 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 91344489 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 524 (Y524D)
Ref Sequence ENSEMBL: ENSMUSP00000086294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088904] [ENSMUST00000176156]
Predicted Effect probably damaging
Transcript: ENSMUST00000088904
AA Change: Y524D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086294
Gene: ENSMUSG00000049515
AA Change: Y524D

DomainStartEndE-ValueType
Blast:ANK 1 33 4e-7 BLAST
ANK 35 64 5.21e1 SMART
ANK 69 102 2.88e2 SMART
ANK 103 132 3.85e-2 SMART
ANK 136 166 7.08e-1 SMART
ANK 170 200 1.02e-1 SMART
ANK 204 232 3.04e0 SMART
ANK 238 267 5.01e-1 SMART
ANK 270 299 1.96e-3 SMART
ANK 303 332 3.21e1 SMART
low complexity region 336 345 N/A INTRINSIC
coiled coil region 509 538 N/A INTRINSIC
low complexity region 820 833 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176156
AA Change: Y480D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135828
Gene: ENSMUSG00000049515
AA Change: Y480D

DomainStartEndE-ValueType
Blast:ANK 1 33 5e-7 BLAST
ANK 35 64 5.21e1 SMART
ANK 69 102 2.88e2 SMART
ANK 103 132 3.85e-2 SMART
ANK 136 166 7.08e-1 SMART
ANK 170 200 1.02e-1 SMART
ANK 204 232 3.04e0 SMART
ANK 238 267 5.01e-1 SMART
low complexity region 292 301 N/A INTRINSIC
coiled coil region 465 494 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 92.5%
  • 20x: 75.9%
Validation Efficiency 97% (121/125)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,871 L1607P probably damaging Het
1700016H13Rik T C 5: 103,648,821 *118W probably null Het
1700061G19Rik A T 17: 56,883,835 N468Y probably benign Het
2610507B11Rik A C 11: 78,269,704 probably benign Het
4930452B06Rik C T 14: 8,518,695 G254R probably damaging Het
Abcc2 A T 19: 43,826,614 R1147* probably null Het
Agap2 A G 10: 127,091,702 T1131A possibly damaging Het
Aldh9a1 A G 1: 167,361,847 D388G probably damaging Het
Ap3d1 G T 10: 80,730,042 A97E probably damaging Het
Arhgef10 T A 8: 14,962,636 V320E probably damaging Het
Baiap2l1 C A 5: 144,266,010 V498L probably damaging Het
Ccdc189 T C 7: 127,584,862 E261G probably damaging Het
Cdh2 T C 18: 16,629,576 N437S probably benign Het
Chd1 C A 17: 15,725,431 N72K probably benign Het
Col4a3bp T A 13: 96,549,287 Y63N probably benign Het
Cstf2t A T 19: 31,084,626 M521L probably benign Het
Dlx5 T C 6: 6,881,619 K90E possibly damaging Het
Dmp1 A G 5: 104,207,630 E32G possibly damaging Het
Fam20c T C 5: 138,755,724 L30P probably damaging Het
Fat1 G T 8: 45,026,553 A2879S probably benign Het
Gabrg1 A T 5: 70,774,389 V337D probably damaging Het
Gart C A 16: 91,623,403 D851Y possibly damaging Het
Gcc1 T C 6: 28,420,616 H234R probably damaging Het
Gemin6 T A 17: 80,228,095 H161Q probably damaging Het
Glt6d1 A G 2: 25,794,070 I308T probably benign Het
Gm10320 T C 13: 98,491,983 T7A probably benign Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm13088 C T 4: 143,656,440 E70K possibly damaging Het
Gmpr2 T A 14: 55,672,735 D7E possibly damaging Het
Hc A G 2: 34,984,750 Y1620H probably damaging Het
Hoxa3 T C 6: 52,170,143 probably benign Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Kdr G T 5: 75,968,422 T188N possibly damaging Het
Lepr A T 4: 101,752,152 D312V possibly damaging Het
Mcm3 A G 1: 20,810,105 V501A probably damaging Het
Mcur1 T C 13: 43,545,740 Y267C probably damaging Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Med13l T C 5: 118,671,002 probably benign Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Ndrg2 T A 14: 51,907,003 probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Olfr558 T A 7: 102,709,995 H245Q probably damaging Het
Onecut2 T A 18: 64,341,472 S365T possibly damaging Het
Pds5b C A 5: 150,754,431 Q505K probably benign Het
Rfx2 T C 17: 56,803,722 Y88C probably damaging Het
Rpl6 T C 5: 121,208,478 V214A probably benign Het
Samd3 T A 10: 26,271,854 C476S possibly damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Shank1 C T 7: 44,352,294 R1146W unknown Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Smpd4 T A 16: 17,641,597 probably null Het
Strip1 C A 3: 107,614,613 D750Y probably damaging Het
Svep1 T C 4: 58,070,851 K2312E possibly damaging Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Tnfaip1 A T 11: 78,530,014 probably benign Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Usp24 T A 4: 106,407,133 W1754R probably damaging Het
Utp20 G A 10: 88,777,516 P1301L probably benign Het
Vmn2r115 T A 17: 23,359,781 S743T probably damaging Het
Vps41 T G 13: 18,854,663 probably null Het
Vps72 G T 3: 95,122,583 L304F probably damaging Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Zfp521 T C 18: 13,845,062 T765A probably benign Het
Zfp616 A T 11: 74,085,674 H923L probably damaging Het
Zp2 A T 7: 120,143,576 probably benign Het
Other mutations in Espnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Espnl APN 1 91340611 nonsense probably null
IGL01726:Espnl APN 1 91344904 missense probably benign
IGL02402:Espnl APN 1 91344813 missense probably benign 0.13
IGL02472:Espnl APN 1 91340534 missense probably benign 0.02
IGL02986:Espnl APN 1 91344850 missense probably benign 0.01
IGL03037:Espnl APN 1 91341921 missense probably benign 0.01
IGL03073:Espnl APN 1 91344556 missense probably damaging 0.99
R0111:Espnl UTSW 1 91344742 missense probably benign 0.29
R0238:Espnl UTSW 1 91322287 missense probably damaging 0.97
R0239:Espnl UTSW 1 91322287 missense probably damaging 0.97
R0239:Espnl UTSW 1 91322287 missense probably damaging 0.97
R0665:Espnl UTSW 1 91334687 intron probably null
R1772:Espnl UTSW 1 91344603 missense possibly damaging 0.61
R3804:Espnl UTSW 1 91322221 missense probably benign 0.00
R4352:Espnl UTSW 1 91334721 missense probably damaging 1.00
R4566:Espnl UTSW 1 91344579 missense possibly damaging 0.46
R4790:Espnl UTSW 1 91344424 missense probably damaging 1.00
R5234:Espnl UTSW 1 91344793 missense probably benign 0.02
R6430:Espnl UTSW 1 91322248 missense possibly damaging 0.75
R6652:Espnl UTSW 1 91344699 missense probably benign 0.13
R6785:Espnl UTSW 1 91322221 missense probably benign 0.00
R6800:Espnl UTSW 1 91342629 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTAGGCTTTAGGGAACCAGGCAG -3'
(R):5'- TTCATACCCTTCAGCAGCAGGGAC -3'

Sequencing Primer
(F):5'- TGTCCAGGACCAGAGTCAG -3'
(R):5'- TGGCTGCACCAGAAGGG -3'
Posted On2013-04-16