Incidental Mutation 'R2156:Spam1'
ID234810
Institutional Source Beutler Lab
Gene Symbol Spam1
Ensembl Gene ENSMUSG00000029682
Gene Namesperm adhesion molecule 1
SynonymsPh-20
MMRRC Submission 040159-MU
Accession Numbers

Genbank: NM_001079875.1, NM_009241.2

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2156 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location24791188-24801048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24796268 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 73 (F73L)
Ref Sequence ENSEMBL: ENSMUSP00000143970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031693] [ENSMUST00000202331] [ENSMUST00000202569]
Predicted Effect probably damaging
Transcript: ENSMUST00000031693
AA Change: F73L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031693
Gene: ENSMUSG00000029682
AA Change: F73L

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 42 373 4.5e-136 PFAM
Blast:EGF 376 439 5e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000202331
AA Change: F73L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143944
Gene: ENSMUSG00000029682
AA Change: F73L

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 42 373 4.5e-136 PFAM
Blast:EGF 376 439 5e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000202569
AA Change: F73L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143970
Gene: ENSMUSG00000029682
AA Change: F73L

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 42 373 4.5e-136 PFAM
Blast:EGF 376 439 5e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202786
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male homozygotes for a targeted null mutation are normally fertile, but in vitro their sperm are slower at clearing cells from the cumulus mass. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,422,308 probably null Het
Acaa2 T C 18: 74,793,405 probably null Het
Adam7 T C 14: 68,511,343 Q485R probably benign Het
Adcy4 T G 14: 55,769,170 T1069P probably benign Het
Arsj T C 3: 126,438,688 L361P probably damaging Het
Birc2 A C 9: 7,826,938 L349R probably damaging Het
C1qa T C 4: 136,896,416 Y159C probably damaging Het
Cdh13 A G 8: 119,236,964 K428E probably damaging Het
Cenpe T C 3: 135,247,474 M1563T probably benign Het
Col10a1 T C 10: 34,395,700 V556A probably benign Het
Creg2 G A 1: 39,623,170 L265F probably damaging Het
Cyp1a2 T A 9: 57,682,150 D127V probably damaging Het
Cyp3a44 A T 5: 145,803,670 Y53* probably null Het
Cyth1 C T 11: 118,182,808 R233Q probably damaging Het
Dnmbp G A 19: 43,901,907 H474Y possibly damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Ercc2 G A 7: 19,386,792 R206H possibly damaging Het
Evx2 T A 2: 74,656,016 H343L probably damaging Het
Fcrls T A 3: 87,257,341 I293F probably benign Het
Gcnt4 A G 13: 96,946,466 E90G probably damaging Het
Gid8 T G 2: 180,716,958 C139G probably benign Het
Gm11938 C A 11: 99,603,107 C54F probably damaging Het
Gm3336 G A 8: 70,721,860 V158I probably benign Het
Gm5415 T A 1: 32,546,047 M261L probably benign Het
Gucy1b1 T C 3: 82,061,020 N60D probably benign Het
Hdac7 T C 15: 97,794,063 K810E probably benign Het
Hsp90ab1 A G 17: 45,569,703 F361L possibly damaging Het
Igf2bp3 A T 6: 49,108,924 probably null Het
Inpp4b T A 8: 82,048,489 I772N probably damaging Het
Iqca A G 1: 90,089,516 L390P possibly damaging Het
Itgb2 C T 10: 77,560,248 R586W probably benign Het
Itih1 A G 14: 30,933,475 S588P possibly damaging Het
Iyd T A 10: 3,547,166 probably null Het
Kl A G 5: 150,988,960 K725E probably benign Het
Layn T A 9: 51,057,397 M349L probably benign Het
Map3k5 T C 10: 20,024,937 Y286H probably damaging Het
Med4 C T 14: 73,518,032 probably benign Het
Mfn1 T A 3: 32,534,251 N42K possibly damaging Het
Mindy2 T C 9: 70,656,592 D152G probably benign Het
Mrc2 A G 11: 105,347,856 probably null Het
Mrpl11 C A 19: 4,962,469 A26E probably damaging Het
Msh6 G A 17: 87,986,140 W774* probably null Het
Mtch1 A T 17: 29,342,867 V121E probably damaging Het
Mtg2 G T 2: 180,084,130 E178* probably null Het
Nbas A T 12: 13,441,509 N1461Y probably damaging Het
Ndfip2 A G 14: 105,287,770 T65A probably benign Het
Ninl G T 2: 150,944,583 Q1146K probably damaging Het
Notch1 T C 2: 26,460,861 D2089G possibly damaging Het
Notch3 C T 17: 32,147,844 V906M probably damaging Het
Olfr606 A G 7: 103,452,164 I276V probably benign Het
Olfr711 A G 7: 106,971,568 Y259H probably damaging Het
Osmr A T 15: 6,844,410 Y169N probably benign Het
Ovgp1 T C 3: 105,977,717 V124A possibly damaging Het
P2rx1 T C 11: 73,014,113 M369T probably benign Het
Pde4dip T C 3: 97,724,218 Q1125R probably damaging Het
Podn A T 4: 108,021,695 V180E probably damaging Het
Pold1 A T 7: 44,539,118 V475E probably damaging Het
Polg A G 7: 79,461,720 I261T possibly damaging Het
Satb1 G T 17: 51,740,410 Q595K probably benign Het
Scaf8 T A 17: 3,164,132 probably null Het
Serpinb3a C T 1: 107,047,472 probably null Het
Slc22a26 T C 19: 7,802,115 D112G probably damaging Het
Slc25a23 A G 17: 57,045,562 F441L probably benign Het
Slc25a53 T C X: 136,983,467 T42A probably damaging Het
Slc6a15 T C 10: 103,393,408 Y103H probably damaging Het
Slx4 A G 16: 3,986,359 S864P probably benign Het
Snap91 T C 9: 86,825,077 E220G probably damaging Het
Sphkap C T 1: 83,277,989 V393M probably benign Het
Spred2 T C 11: 20,021,241 Y370H probably damaging Het
Sqle T C 15: 59,323,729 probably null Het
Srrm2 A G 17: 23,818,263 T1390A probably benign Het
Tas1r2 A G 4: 139,669,041 R564G possibly damaging Het
Tbl2 G T 5: 135,156,520 probably null Het
Tcof1 T C 18: 60,831,829 D606G possibly damaging Het
Tdpoz3 T A 3: 93,826,780 L254H probably damaging Het
Trpm1 A T 7: 64,234,988 I806F probably damaging Het
Ttc22 A G 4: 106,639,040 D429G probably benign Het
Ube2o C A 11: 116,581,146 G90C probably damaging Het
Usp34 T A 11: 23,382,602 F1110I probably damaging Het
Vmn2r82 T C 10: 79,378,888 L235P probably damaging Het
Vps35 A G 8: 85,286,500 V116A probably benign Het
Wdfy3 A G 5: 101,898,425 probably null Het
Zeb2 T C 2: 44,988,809 K1138E probably benign Het
Zfp513 G A 5: 31,200,522 T169I probably benign Het
Zfp629 T C 7: 127,612,379 D86G probably benign Het
Other mutations in Spam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Spam1 APN 6 24796723 nonsense probably null
IGL02152:Spam1 APN 6 24800803 utr 3 prime probably benign
IGL02377:Spam1 APN 6 24796697 missense probably damaging 1.00
IGL02666:Spam1 APN 6 24796124 missense possibly damaging 0.67
IGL02968:Spam1 APN 6 24796443 missense possibly damaging 0.84
IGL03004:Spam1 APN 6 24796914 missense probably damaging 1.00
IGL03136:Spam1 APN 6 24797011 splice site probably benign
I2288:Spam1 UTSW 6 24796478 missense probably benign 0.00
I2289:Spam1 UTSW 6 24796478 missense probably benign 0.00
R0279:Spam1 UTSW 6 24800419 missense probably benign
R0454:Spam1 UTSW 6 24797838 missense probably damaging 0.99
R0486:Spam1 UTSW 6 24796395 missense probably damaging 1.00
R0734:Spam1 UTSW 6 24796949 missense probably benign 0.17
R0811:Spam1 UTSW 6 24796887 missense probably damaging 1.00
R0812:Spam1 UTSW 6 24796887 missense probably damaging 1.00
R1294:Spam1 UTSW 6 24796907 missense probably benign 0.12
R1703:Spam1 UTSW 6 24796257 missense probably damaging 1.00
R2163:Spam1 UTSW 6 24796847 missense probably benign 0.33
R2762:Spam1 UTSW 6 24796643 missense possibly damaging 0.94
R2970:Spam1 UTSW 6 24796725 missense probably damaging 1.00
R4646:Spam1 UTSW 6 24800587 missense probably benign 0.01
R4664:Spam1 UTSW 6 24796662 missense probably benign 0.01
R4923:Spam1 UTSW 6 24796656 missense probably damaging 1.00
R5452:Spam1 UTSW 6 24800732 missense probably benign 0.00
R5589:Spam1 UTSW 6 24796110 missense probably benign 0.01
R5591:Spam1 UTSW 6 24800546 missense probably damaging 0.99
R5861:Spam1 UTSW 6 24796571 missense probably benign
R6481:Spam1 UTSW 6 24796930 missense probably benign 0.01
R6564:Spam1 UTSW 6 24796356 missense possibly damaging 0.90
R6754:Spam1 UTSW 6 24796316 missense probably damaging 0.97
R7103:Spam1 UTSW 6 24800584 missense probably benign 0.00
X0022:Spam1 UTSW 6 24797886 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- ACTGGACAGACCACAGTGTG -3'
(R):5'- TGTCAGTCTTAGCTTTGCGC -3'

Sequencing Primer
(F):5'- TGGGAGAGTTGAGATTTAAGCACCTC -3'
(R):5'- CTTAGCTTTGCGCAAATGAGC -3'
Posted On2014-10-01