Incidental Mutation 'R2156:Cdh13'
ID234825
Institutional Source Beutler Lab
Gene Symbol Cdh13
Ensembl Gene ENSMUSG00000031841
Gene Namecadherin 13
SynonymsT-cadherin, 4932416G01Rik, Tcad
MMRRC Submission 040159-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2156 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location118283733-119324921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119236964 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 428 (K428E)
Ref Sequence ENSEMBL: ENSMUSP00000113527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117160]
PDB Structure
Crystal Structure of mouse T-cadherin EC1 EC2 [X-RAY DIFFRACTION]
Crystal structure of mouse T-cadherin EC1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000117160
AA Change: K428E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113527
Gene: ENSMUSG00000031841
AA Change: K428E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Cadherin_pro 26 112 1.04e-17 SMART
CA 160 243 1.49e-18 SMART
CA 267 361 1.84e-23 SMART
CA 383 476 8.75e-16 SMART
CA 499 583 2.36e-21 SMART
CA 604 687 5.93e-2 SMART
low complexity region 695 714 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212476
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. This gene is highly expressed in the vasculature including endothelial cells, smooth muscle cells and pericytes, where the encoded protein binds to adiponectin and has been implicated in the modulation of angiogenesis. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased retinal neovascularization and increased adiponectin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,422,308 probably null Het
Acaa2 T C 18: 74,793,405 probably null Het
Adam7 T C 14: 68,511,343 Q485R probably benign Het
Adcy4 T G 14: 55,769,170 T1069P probably benign Het
Arsj T C 3: 126,438,688 L361P probably damaging Het
Birc2 A C 9: 7,826,938 L349R probably damaging Het
C1qa T C 4: 136,896,416 Y159C probably damaging Het
Cenpe T C 3: 135,247,474 M1563T probably benign Het
Col10a1 T C 10: 34,395,700 V556A probably benign Het
Creg2 G A 1: 39,623,170 L265F probably damaging Het
Cyp1a2 T A 9: 57,682,150 D127V probably damaging Het
Cyp3a44 A T 5: 145,803,670 Y53* probably null Het
Cyth1 C T 11: 118,182,808 R233Q probably damaging Het
Dnmbp G A 19: 43,901,907 H474Y possibly damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Ercc2 G A 7: 19,386,792 R206H possibly damaging Het
Evx2 T A 2: 74,656,016 H343L probably damaging Het
Fcrls T A 3: 87,257,341 I293F probably benign Het
Gcnt4 A G 13: 96,946,466 E90G probably damaging Het
Gid8 T G 2: 180,716,958 C139G probably benign Het
Gm11938 C A 11: 99,603,107 C54F probably damaging Het
Gm3336 G A 8: 70,721,860 V158I probably benign Het
Gm5415 T A 1: 32,546,047 M261L probably benign Het
Gucy1b1 T C 3: 82,061,020 N60D probably benign Het
Hdac7 T C 15: 97,794,063 K810E probably benign Het
Hsp90ab1 A G 17: 45,569,703 F361L possibly damaging Het
Igf2bp3 A T 6: 49,108,924 probably null Het
Inpp4b T A 8: 82,048,489 I772N probably damaging Het
Iqca A G 1: 90,089,516 L390P possibly damaging Het
Itgb2 C T 10: 77,560,248 R586W probably benign Het
Itih1 A G 14: 30,933,475 S588P possibly damaging Het
Iyd T A 10: 3,547,166 probably null Het
Kl A G 5: 150,988,960 K725E probably benign Het
Layn T A 9: 51,057,397 M349L probably benign Het
Map3k5 T C 10: 20,024,937 Y286H probably damaging Het
Med4 C T 14: 73,518,032 probably benign Het
Mfn1 T A 3: 32,534,251 N42K possibly damaging Het
Mindy2 T C 9: 70,656,592 D152G probably benign Het
Mrc2 A G 11: 105,347,856 probably null Het
Mrpl11 C A 19: 4,962,469 A26E probably damaging Het
Msh6 G A 17: 87,986,140 W774* probably null Het
Mtch1 A T 17: 29,342,867 V121E probably damaging Het
Mtg2 G T 2: 180,084,130 E178* probably null Het
Nbas A T 12: 13,441,509 N1461Y probably damaging Het
Ndfip2 A G 14: 105,287,770 T65A probably benign Het
Ninl G T 2: 150,944,583 Q1146K probably damaging Het
Notch1 T C 2: 26,460,861 D2089G possibly damaging Het
Notch3 C T 17: 32,147,844 V906M probably damaging Het
Olfr606 A G 7: 103,452,164 I276V probably benign Het
Olfr711 A G 7: 106,971,568 Y259H probably damaging Het
Osmr A T 15: 6,844,410 Y169N probably benign Het
Ovgp1 T C 3: 105,977,717 V124A possibly damaging Het
P2rx1 T C 11: 73,014,113 M369T probably benign Het
Pde4dip T C 3: 97,724,218 Q1125R probably damaging Het
Podn A T 4: 108,021,695 V180E probably damaging Het
Pold1 A T 7: 44,539,118 V475E probably damaging Het
Polg A G 7: 79,461,720 I261T possibly damaging Het
Satb1 G T 17: 51,740,410 Q595K probably benign Het
Scaf8 T A 17: 3,164,132 probably null Het
Serpinb3a C T 1: 107,047,472 probably null Het
Slc22a26 T C 19: 7,802,115 D112G probably damaging Het
Slc25a23 A G 17: 57,045,562 F441L probably benign Het
Slc25a53 T C X: 136,983,467 T42A probably damaging Het
Slc6a15 T C 10: 103,393,408 Y103H probably damaging Het
Slx4 A G 16: 3,986,359 S864P probably benign Het
Snap91 T C 9: 86,825,077 E220G probably damaging Het
Spam1 T C 6: 24,796,268 F73L probably damaging Het
Sphkap C T 1: 83,277,989 V393M probably benign Het
Spred2 T C 11: 20,021,241 Y370H probably damaging Het
Sqle T C 15: 59,323,729 probably null Het
Srrm2 A G 17: 23,818,263 T1390A probably benign Het
Tas1r2 A G 4: 139,669,041 R564G possibly damaging Het
Tbl2 G T 5: 135,156,520 probably null Het
Tcof1 T C 18: 60,831,829 D606G possibly damaging Het
Tdpoz3 T A 3: 93,826,780 L254H probably damaging Het
Trpm1 A T 7: 64,234,988 I806F probably damaging Het
Ttc22 A G 4: 106,639,040 D429G probably benign Het
Ube2o C A 11: 116,581,146 G90C probably damaging Het
Usp34 T A 11: 23,382,602 F1110I probably damaging Het
Vmn2r82 T C 10: 79,378,888 L235P probably damaging Het
Vps35 A G 8: 85,286,500 V116A probably benign Het
Wdfy3 A G 5: 101,898,425 probably null Het
Zeb2 T C 2: 44,988,809 K1138E probably benign Het
Zfp513 G A 5: 31,200,522 T169I probably benign Het
Zfp629 T C 7: 127,612,379 D86G probably benign Het
Other mutations in Cdh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Cdh13 APN 8 119312506 missense possibly damaging 0.87
IGL00659:Cdh13 APN 8 119312667 missense probably damaging 1.00
IGL01662:Cdh13 APN 8 118675177 missense probably damaging 0.99
IGL01719:Cdh13 APN 8 118675188 missense probably benign 0.01
IGL02148:Cdh13 APN 8 119198958 missense probably damaging 1.00
IGL02157:Cdh13 APN 8 118505671 missense possibly damaging 0.68
IGL02188:Cdh13 APN 8 118851761 missense probably benign 0.08
IGL02490:Cdh13 APN 8 119095323 missense probably damaging 1.00
IGL02851:Cdh13 APN 8 118675158 missense probably benign 0.32
IGL02958:Cdh13 APN 8 119312721 missense possibly damaging 0.90
IGL03085:Cdh13 APN 8 119288724 missense probably damaging 1.00
IGL03230:Cdh13 APN 8 119242317 missense probably damaging 1.00
IGL03280:Cdh13 APN 8 119314134 missense probably damaging 1.00
K3955:Cdh13 UTSW 8 118675104 missense probably damaging 0.99
P0038:Cdh13 UTSW 8 118675104 missense probably damaging 0.99
R0398:Cdh13 UTSW 8 119314047 missense probably damaging 1.00
R3415:Cdh13 UTSW 8 118675207 missense probably benign 0.35
R4243:Cdh13 UTSW 8 119242257 missense probably damaging 1.00
R4839:Cdh13 UTSW 8 118851848 nonsense probably null
R4851:Cdh13 UTSW 8 118757390 missense possibly damaging 0.75
R5129:Cdh13 UTSW 8 119095215 missense probably damaging 1.00
R5453:Cdh13 UTSW 8 119198967 missense probably damaging 1.00
R5607:Cdh13 UTSW 8 118757474 missense probably benign
R5608:Cdh13 UTSW 8 118757474 missense probably benign
R5610:Cdh13 UTSW 8 118851723 missense possibly damaging 0.95
R6035:Cdh13 UTSW 8 118505698 missense probably benign 0.03
R6035:Cdh13 UTSW 8 118505698 missense probably benign 0.03
R6556:Cdh13 UTSW 8 118968187 missense probably damaging 0.99
R7124:Cdh13 UTSW 8 118968173 missense probably damaging 1.00
R7349:Cdh13 UTSW 8 119242358 missense probably damaging 0.97
R7418:Cdh13 UTSW 8 119312525 missense probably damaging 1.00
X0025:Cdh13 UTSW 8 118505679 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TTTCAAGCCACAGTGGAGGAG -3'
(R):5'- AGATCAAGGTTCCTGCTCTGC -3'

Sequencing Primer
(F):5'- CCACAGTGGAGGAGGGAGC -3'
(R):5'- CCTGCCTTAGAAGCAAACAGGG -3'
Posted On2014-10-01