Incidental Mutation 'R0197:Vps72'
ID23483
Institutional Source Beutler Lab
Gene Symbol Vps72
Ensembl Gene ENSMUSG00000008958
Gene Namevacuolar protein sorting 72
SynonymsYL-1, Tcfl1
MMRRC Submission 038456-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.910) question?
Stock #R0197 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95111022-95123051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 95122583 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 304 (L304F)
Ref Sequence ENSEMBL: ENSMUSP00000009102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005769] [ENSMUST00000009102] [ENSMUST00000107227] [ENSMUST00000131597]
Predicted Effect probably benign
Transcript: ENSMUST00000005769
SMART Domains Protein: ENSMUSP00000005769
Gene: ENSMUSG00000005628

DomainStartEndE-ValueType
Pfam:Tropomodulin 4 143 2.7e-62 PFAM
PDB:1IO0|A 160 343 6e-77 PDB
SCOP:d1a4ya_ 184 289 4e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000009102
AA Change: L304F

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000009102
Gene: ENSMUSG00000008958
AA Change: L304F

DomainStartEndE-ValueType
Pfam:YL1 5 216 5.1e-58 PFAM
low complexity region 247 264 N/A INTRINSIC
YL1_C 294 323 5.99e-9 SMART
low complexity region 335 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107227
SMART Domains Protein: ENSMUSP00000102846
Gene: ENSMUSG00000005628

DomainStartEndE-ValueType
Pfam:Tropomodulin 1 144 4.4e-72 PFAM
PDB:1IO0|A 160 343 6e-77 PDB
SCOP:d1a4ya_ 184 289 4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130545
Predicted Effect probably benign
Transcript: ENSMUST00000131597
SMART Domains Protein: ENSMUSP00000116341
Gene: ENSMUSG00000005628

DomainStartEndE-ValueType
Pfam:Tropomodulin 1 144 1.5e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152333
Meta Mutation Damage Score 0.0296 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 92.5%
  • 20x: 75.9%
Validation Efficiency 97% (121/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a shared subunit of two multi-component complexes, the histone acetyltransferase complex TRRAP/TIP60 as well as the chromatin remodeling SRCAP-containing complex. The TRRAP/TIP60 complex acetylates nucleosomal histones important for transcriptional regulation, double strand DNA break repair and apoptosis. The SRCAP-containing complex catalyzes the exchange of histone H2A with the histone variant Htz1 (H2AFZ) into nucleosomes. This protein may be responsible for binding H2AFZ, which has a role in chromosome segregation. This protein may also have a role in regulating long-term hematopoietic stem cell activity. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,871 L1607P probably damaging Het
1700016H13Rik T C 5: 103,648,821 *118W probably null Het
1700061G19Rik A T 17: 56,883,835 N468Y probably benign Het
2610507B11Rik A C 11: 78,269,704 probably benign Het
4930452B06Rik C T 14: 8,518,695 G254R probably damaging Het
Abcc2 A T 19: 43,826,614 R1147* probably null Het
Agap2 A G 10: 127,091,702 T1131A possibly damaging Het
Aldh9a1 A G 1: 167,361,847 D388G probably damaging Het
Ap3d1 G T 10: 80,730,042 A97E probably damaging Het
Arhgef10 T A 8: 14,962,636 V320E probably damaging Het
Baiap2l1 C A 5: 144,266,010 V498L probably damaging Het
Ccdc189 T C 7: 127,584,862 E261G probably damaging Het
Cdh2 T C 18: 16,629,576 N437S probably benign Het
Chd1 C A 17: 15,725,431 N72K probably benign Het
Col4a3bp T A 13: 96,549,287 Y63N probably benign Het
Cstf2t A T 19: 31,084,626 M521L probably benign Het
Dlx5 T C 6: 6,881,619 K90E possibly damaging Het
Dmp1 A G 5: 104,207,630 E32G possibly damaging Het
Espnl T G 1: 91,344,489 Y524D probably damaging Het
Fam20c T C 5: 138,755,724 L30P probably damaging Het
Fat1 G T 8: 45,026,553 A2879S probably benign Het
Gabrg1 A T 5: 70,774,389 V337D probably damaging Het
Gart C A 16: 91,623,403 D851Y possibly damaging Het
Gcc1 T C 6: 28,420,616 H234R probably damaging Het
Gemin6 T A 17: 80,228,095 H161Q probably damaging Het
Glt6d1 A G 2: 25,794,070 I308T probably benign Het
Gm10320 T C 13: 98,491,983 T7A probably benign Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm13088 C T 4: 143,656,440 E70K possibly damaging Het
Gmpr2 T A 14: 55,672,735 D7E possibly damaging Het
Hc A G 2: 34,984,750 Y1620H probably damaging Het
Hoxa3 T C 6: 52,170,143 probably benign Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Kdr G T 5: 75,968,422 T188N possibly damaging Het
Lepr A T 4: 101,752,152 D312V possibly damaging Het
Mcm3 A G 1: 20,810,105 V501A probably damaging Het
Mcur1 T C 13: 43,545,740 Y267C probably damaging Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Med13l T C 5: 118,671,002 probably benign Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Ndrg2 T A 14: 51,907,003 probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Olfr558 T A 7: 102,709,995 H245Q probably damaging Het
Onecut2 T A 18: 64,341,472 S365T possibly damaging Het
Pds5b C A 5: 150,754,431 Q505K probably benign Het
Rfx2 T C 17: 56,803,722 Y88C probably damaging Het
Rpl6 T C 5: 121,208,478 V214A probably benign Het
Samd3 T A 10: 26,271,854 C476S possibly damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Shank1 C T 7: 44,352,294 R1146W unknown Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Smpd4 T A 16: 17,641,597 probably null Het
Strip1 C A 3: 107,614,613 D750Y probably damaging Het
Svep1 T C 4: 58,070,851 K2312E possibly damaging Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Tnfaip1 A T 11: 78,530,014 probably benign Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Usp24 T A 4: 106,407,133 W1754R probably damaging Het
Utp20 G A 10: 88,777,516 P1301L probably benign Het
Vmn2r115 T A 17: 23,359,781 S743T probably damaging Het
Vps41 T G 13: 18,854,663 probably null Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Zfp521 T C 18: 13,845,062 T765A probably benign Het
Zfp616 A T 11: 74,085,674 H923L probably damaging Het
Zp2 A T 7: 120,143,576 probably benign Het
Other mutations in Vps72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02051:Vps72 APN 3 95122729 missense possibly damaging 0.96
IGL02802:Vps72 UTSW 3 95119234 nonsense probably null
R0135:Vps72 UTSW 3 95119197 missense probably damaging 0.99
R0463:Vps72 UTSW 3 95121304 missense probably benign 0.41
R0883:Vps72 UTSW 3 95122583 missense probably damaging 0.97
R1101:Vps72 UTSW 3 95119176 missense probably damaging 1.00
R1484:Vps72 UTSW 3 95119151 missense probably damaging 1.00
R1698:Vps72 UTSW 3 95118695 missense probably benign 0.00
R1839:Vps72 UTSW 3 95119218 missense possibly damaging 0.70
R1935:Vps72 UTSW 3 95122540 missense probably benign 0.01
R1936:Vps72 UTSW 3 95122540 missense probably benign 0.01
R3011:Vps72 UTSW 3 95119274 missense probably damaging 1.00
R4877:Vps72 UTSW 3 95118187 intron probably benign
Predicted Primers PCR Primer
(F):5'- GGTAAATACTGAGGTCACAGCCAGC -3'
(R):5'- TGACAATCTTCTGACGCAAGGCTC -3'

Sequencing Primer
(F):5'- CTACAGCCTCTGCACTGG -3'
(R):5'- TCGAGGCCCAGAGCCAG -3'
Posted On2013-04-16