Incidental Mutation 'R2156:Snap91'
ID234830
Institutional Source Beutler Lab
Gene Symbol Snap91
Ensembl Gene ENSMUSG00000033419
Gene Namesynaptosomal-associated protein 91
SynonymsF1-20, AP180, 91kDa
MMRRC Submission 040159-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.888) question?
Stock #R2156 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location86765923-86880654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86825077 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 220 (E220G)
Ref Sequence ENSEMBL: ENSMUSP00000074066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036347] [ENSMUST00000074468] [ENSMUST00000074501] [ENSMUST00000098495]
Predicted Effect probably damaging
Transcript: ENSMUST00000036347
AA Change: E220G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046189
Gene: ENSMUSG00000033419
AA Change: E220G

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 334 347 N/A INTRINSIC
low complexity region 357 374 N/A INTRINSIC
low complexity region 403 433 N/A INTRINSIC
low complexity region 439 466 N/A INTRINSIC
low complexity region 477 488 N/A INTRINSIC
low complexity region 499 558 N/A INTRINSIC
internal_repeat_1 559 586 3.27e-5 PROSPERO
internal_repeat_1 584 611 3.27e-5 PROSPERO
low complexity region 616 634 N/A INTRINSIC
low complexity region 652 669 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 728 757 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 850 862 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074468
AA Change: E220G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074066
Gene: ENSMUSG00000033419
AA Change: E220G

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 334 347 N/A INTRINSIC
low complexity region 357 374 N/A INTRINSIC
low complexity region 403 433 N/A INTRINSIC
low complexity region 439 466 N/A INTRINSIC
low complexity region 477 488 N/A INTRINSIC
low complexity region 499 558 N/A INTRINSIC
internal_repeat_1 559 586 6.86e-5 PROSPERO
internal_repeat_1 584 611 6.86e-5 PROSPERO
low complexity region 616 634 N/A INTRINSIC
low complexity region 652 669 N/A INTRINSIC
low complexity region 702 717 N/A INTRINSIC
low complexity region 733 762 N/A INTRINSIC
low complexity region 833 847 N/A INTRINSIC
low complexity region 883 895 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074501
AA Change: E220G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074095
Gene: ENSMUSG00000033419
AA Change: E220G

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 355 382 N/A INTRINSIC
low complexity region 409 424 N/A INTRINSIC
low complexity region 440 469 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098495
AA Change: E220G

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096096
Gene: ENSMUSG00000033419
AA Change: E220G

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 355 372 N/A INTRINSIC
low complexity region 396 426 N/A INTRINSIC
low complexity region 432 459 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
low complexity region 492 551 N/A INTRINSIC
internal_repeat_1 552 579 4.67e-5 PROSPERO
internal_repeat_1 577 604 4.67e-5 PROSPERO
low complexity region 609 627 N/A INTRINSIC
low complexity region 667 682 N/A INTRINSIC
low complexity region 698 727 N/A INTRINSIC
low complexity region 772 784 N/A INTRINSIC
low complexity region 820 832 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167014
SMART Domains Protein: ENSMUSP00000128738
Gene: ENSMUSG00000033419

DomainStartEndE-ValueType
ENTH 20 145 8.41e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189762
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display postnatal growth retardation, limb clasping, altered behavior, defects in synaptic vesicle reformation, impaired neurotransmission, excitatory/inhibitory imbalance, epileptic seizures, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,422,308 probably null Het
Acaa2 T C 18: 74,793,405 probably null Het
Adam7 T C 14: 68,511,343 Q485R probably benign Het
Adcy4 T G 14: 55,769,170 T1069P probably benign Het
Arsj T C 3: 126,438,688 L361P probably damaging Het
Birc2 A C 9: 7,826,938 L349R probably damaging Het
C1qa T C 4: 136,896,416 Y159C probably damaging Het
Cdh13 A G 8: 119,236,964 K428E probably damaging Het
Cenpe T C 3: 135,247,474 M1563T probably benign Het
Col10a1 T C 10: 34,395,700 V556A probably benign Het
Creg2 G A 1: 39,623,170 L265F probably damaging Het
Cyp1a2 T A 9: 57,682,150 D127V probably damaging Het
Cyp3a44 A T 5: 145,803,670 Y53* probably null Het
Cyth1 C T 11: 118,182,808 R233Q probably damaging Het
Dnmbp G A 19: 43,901,907 H474Y possibly damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Ercc2 G A 7: 19,386,792 R206H possibly damaging Het
Evx2 T A 2: 74,656,016 H343L probably damaging Het
Fcrls T A 3: 87,257,341 I293F probably benign Het
Gcnt4 A G 13: 96,946,466 E90G probably damaging Het
Gid8 T G 2: 180,716,958 C139G probably benign Het
Gm11938 C A 11: 99,603,107 C54F probably damaging Het
Gm3336 G A 8: 70,721,860 V158I probably benign Het
Gm5415 T A 1: 32,546,047 M261L probably benign Het
Gucy1b1 T C 3: 82,061,020 N60D probably benign Het
Hdac7 T C 15: 97,794,063 K810E probably benign Het
Hsp90ab1 A G 17: 45,569,703 F361L possibly damaging Het
Igf2bp3 A T 6: 49,108,924 probably null Het
Inpp4b T A 8: 82,048,489 I772N probably damaging Het
Iqca A G 1: 90,089,516 L390P possibly damaging Het
Itgb2 C T 10: 77,560,248 R586W probably benign Het
Itih1 A G 14: 30,933,475 S588P possibly damaging Het
Iyd T A 10: 3,547,166 probably null Het
Kl A G 5: 150,988,960 K725E probably benign Het
Layn T A 9: 51,057,397 M349L probably benign Het
Map3k5 T C 10: 20,024,937 Y286H probably damaging Het
Med4 C T 14: 73,518,032 probably benign Het
Mfn1 T A 3: 32,534,251 N42K possibly damaging Het
Mindy2 T C 9: 70,656,592 D152G probably benign Het
Mrc2 A G 11: 105,347,856 probably null Het
Mrpl11 C A 19: 4,962,469 A26E probably damaging Het
Msh6 G A 17: 87,986,140 W774* probably null Het
Mtch1 A T 17: 29,342,867 V121E probably damaging Het
Mtg2 G T 2: 180,084,130 E178* probably null Het
Nbas A T 12: 13,441,509 N1461Y probably damaging Het
Ndfip2 A G 14: 105,287,770 T65A probably benign Het
Ninl G T 2: 150,944,583 Q1146K probably damaging Het
Notch1 T C 2: 26,460,861 D2089G possibly damaging Het
Notch3 C T 17: 32,147,844 V906M probably damaging Het
Olfr606 A G 7: 103,452,164 I276V probably benign Het
Olfr711 A G 7: 106,971,568 Y259H probably damaging Het
Osmr A T 15: 6,844,410 Y169N probably benign Het
Ovgp1 T C 3: 105,977,717 V124A possibly damaging Het
P2rx1 T C 11: 73,014,113 M369T probably benign Het
Pde4dip T C 3: 97,724,218 Q1125R probably damaging Het
Podn A T 4: 108,021,695 V180E probably damaging Het
Pold1 A T 7: 44,539,118 V475E probably damaging Het
Polg A G 7: 79,461,720 I261T possibly damaging Het
Satb1 G T 17: 51,740,410 Q595K probably benign Het
Scaf8 T A 17: 3,164,132 probably null Het
Serpinb3a C T 1: 107,047,472 probably null Het
Slc22a26 T C 19: 7,802,115 D112G probably damaging Het
Slc25a23 A G 17: 57,045,562 F441L probably benign Het
Slc25a53 T C X: 136,983,467 T42A probably damaging Het
Slc6a15 T C 10: 103,393,408 Y103H probably damaging Het
Slx4 A G 16: 3,986,359 S864P probably benign Het
Spam1 T C 6: 24,796,268 F73L probably damaging Het
Sphkap C T 1: 83,277,989 V393M probably benign Het
Spred2 T C 11: 20,021,241 Y370H probably damaging Het
Sqle T C 15: 59,323,729 probably null Het
Srrm2 A G 17: 23,818,263 T1390A probably benign Het
Tas1r2 A G 4: 139,669,041 R564G possibly damaging Het
Tbl2 G T 5: 135,156,520 probably null Het
Tcof1 T C 18: 60,831,829 D606G possibly damaging Het
Tdpoz3 T A 3: 93,826,780 L254H probably damaging Het
Trpm1 A T 7: 64,234,988 I806F probably damaging Het
Ttc22 A G 4: 106,639,040 D429G probably benign Het
Ube2o C A 11: 116,581,146 G90C probably damaging Het
Usp34 T A 11: 23,382,602 F1110I probably damaging Het
Vmn2r82 T C 10: 79,378,888 L235P probably damaging Het
Vps35 A G 8: 85,286,500 V116A probably benign Het
Wdfy3 A G 5: 101,898,425 probably null Het
Zeb2 T C 2: 44,988,809 K1138E probably benign Het
Zfp513 G A 5: 31,200,522 T169I probably benign Het
Zfp629 T C 7: 127,612,379 D86G probably benign Het
Other mutations in Snap91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Snap91 APN 9 86821737 missense probably benign 0.01
IGL01147:Snap91 APN 9 86798558 missense probably benign 0.37
IGL01358:Snap91 APN 9 86806560 missense probably damaging 1.00
IGL01501:Snap91 APN 9 86838125 missense probably damaging 0.99
IGL01883:Snap91 APN 9 86775612 missense probably damaging 1.00
IGL02632:Snap91 APN 9 86839522 missense possibly damaging 0.94
IGL02864:Snap91 APN 9 86838088 missense possibly damaging 0.95
IGL03276:Snap91 APN 9 86825012 missense possibly damaging 0.78
PIT4514001:Snap91 UTSW 9 86879433 missense possibly damaging 0.86
R1564:Snap91 UTSW 9 86792196 missense possibly damaging 0.85
R1804:Snap91 UTSW 9 86783417 missense probably benign 0.01
R1840:Snap91 UTSW 9 86815465 missense probably damaging 1.00
R1869:Snap91 UTSW 9 86790141 critical splice acceptor site probably null
R2221:Snap91 UTSW 9 86792527 missense possibly damaging 0.53
R2223:Snap91 UTSW 9 86792527 missense possibly damaging 0.53
R2233:Snap91 UTSW 9 86798571 missense probably benign 0.23
R2680:Snap91 UTSW 9 86879550 start codon destroyed probably null 1.00
R3077:Snap91 UTSW 9 86838854 missense possibly damaging 0.95
R3702:Snap91 UTSW 9 86806520 missense probably damaging 0.99
R3840:Snap91 UTSW 9 86839565 missense probably damaging 1.00
R3912:Snap91 UTSW 9 86792557 missense possibly damaging 0.53
R3913:Snap91 UTSW 9 86792557 missense possibly damaging 0.53
R3958:Snap91 UTSW 9 86838130 missense probably damaging 1.00
R3963:Snap91 UTSW 9 86775612 missense probably damaging 1.00
R4043:Snap91 UTSW 9 86777049 missense probably damaging 1.00
R4133:Snap91 UTSW 9 86777049 missense probably damaging 1.00
R4641:Snap91 UTSW 9 86879475 missense probably damaging 1.00
R4674:Snap91 UTSW 9 86792017 missense possibly damaging 0.73
R4770:Snap91 UTSW 9 86773601 missense possibly damaging 0.86
R4798:Snap91 UTSW 9 86783454 intron probably benign
R4849:Snap91 UTSW 9 86792560 missense possibly damaging 0.53
R4991:Snap91 UTSW 9 86790154 splice site probably null
R5200:Snap91 UTSW 9 86815444 missense probably damaging 1.00
R5354:Snap91 UTSW 9 86835124 missense possibly damaging 0.84
R5644:Snap91 UTSW 9 86790153 splice site probably null
R6029:Snap91 UTSW 9 86825080 splice site probably null
R6091:Snap91 UTSW 9 86839628 missense probably damaging 1.00
R6175:Snap91 UTSW 9 86825000 missense probably damaging 1.00
R6191:Snap91 UTSW 9 86838052 missense probably damaging 1.00
R6611:Snap91 UTSW 9 86790127 missense probably benign 0.33
R6764:Snap91 UTSW 9 86792181 missense probably benign 0.33
R6881:Snap91 UTSW 9 86773593 missense possibly damaging 0.73
R7223:Snap91 UTSW 9 86879557 start gained probably benign
R7247:Snap91 UTSW 9 86792616 missense unknown
R7327:Snap91 UTSW 9 86773545 missense unknown
X0027:Snap91 UTSW 9 86798828 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTAACACATCCTGGGCATG -3'
(R):5'- TTTCAGTGAGACAGATGAACGG -3'

Sequencing Primer
(F):5'- TAACACATCCTGGGCATGTGCTAG -3'
(R):5'- GGCGCCATTCTGAGATGAAC -3'
Posted On2014-10-01