Incidental Mutation 'R2156:P2rx1'
ID234842
Institutional Source Beutler Lab
Gene Symbol P2rx1
Ensembl Gene ENSMUSG00000020787
Gene Namepurinergic receptor P2X, ligand-gated ion channel, 1
SynonymsP2X1 receptor, P2x, Pdcd3, RP-2
MMRRC Submission 040159-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2156 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location72999103-73015200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73014113 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 369 (M369T)
Ref Sequence ENSEMBL: ENSMUSP00000090614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021141] [ENSMUST00000092937] [ENSMUST00000092938]
Predicted Effect probably benign
Transcript: ENSMUST00000021141
AA Change: M396T

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000021141
Gene: ENSMUSG00000020787
AA Change: M396T

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 376 1.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092937
SMART Domains Protein: ENSMUSP00000090613
Gene: ENSMUSG00000020785

DomainStartEndE-ValueType
S_TKc 128 409 7.77e-94 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092938
AA Change: M369T

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000090614
Gene: ENSMUSG00000020787
AA Change: M369T

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 182 1.1e-71 PFAM
Pfam:P2X_receptor 171 355 2.1e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180695
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the P2X family of G-protein-coupled receptors. These proteins can form homo-and heterotimers and function as ATP-gated ion channels and mediate rapid and selective permeability to cations. This protein is primarily localized to smooth muscle where binds ATP and mediates synaptic transmission between neurons and from neurons to smooth muscle and may being responsible for sympathetic vasoconstriction in small arteries, arterioles and vas deferens. Mouse studies suggest that this receptor is essential for normal male reproductive function. This protein may also be involved in promoting apoptosis. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit low male fertility due to impaired vas deferens contraction and reduced numbers of ejaculated sperm. Mutants also show mild hypertension and reduced susceptibility to experimental thromboembolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik T A 11: 58,422,308 probably null Het
Acaa2 T C 18: 74,793,405 probably null Het
Adam7 T C 14: 68,511,343 Q485R probably benign Het
Adcy4 T G 14: 55,769,170 T1069P probably benign Het
Arsj T C 3: 126,438,688 L361P probably damaging Het
Birc2 A C 9: 7,826,938 L349R probably damaging Het
C1qa T C 4: 136,896,416 Y159C probably damaging Het
Cdh13 A G 8: 119,236,964 K428E probably damaging Het
Cenpe T C 3: 135,247,474 M1563T probably benign Het
Col10a1 T C 10: 34,395,700 V556A probably benign Het
Creg2 G A 1: 39,623,170 L265F probably damaging Het
Cyp1a2 T A 9: 57,682,150 D127V probably damaging Het
Cyp3a44 A T 5: 145,803,670 Y53* probably null Het
Cyth1 C T 11: 118,182,808 R233Q probably damaging Het
Dnmbp G A 19: 43,901,907 H474Y possibly damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Ercc2 G A 7: 19,386,792 R206H possibly damaging Het
Evx2 T A 2: 74,656,016 H343L probably damaging Het
Fcrls T A 3: 87,257,341 I293F probably benign Het
Gcnt4 A G 13: 96,946,466 E90G probably damaging Het
Gid8 T G 2: 180,716,958 C139G probably benign Het
Gm11938 C A 11: 99,603,107 C54F probably damaging Het
Gm3336 G A 8: 70,721,860 V158I probably benign Het
Gm5415 T A 1: 32,546,047 M261L probably benign Het
Gucy1b1 T C 3: 82,061,020 N60D probably benign Het
Hdac7 T C 15: 97,794,063 K810E probably benign Het
Hsp90ab1 A G 17: 45,569,703 F361L possibly damaging Het
Igf2bp3 A T 6: 49,108,924 probably null Het
Inpp4b T A 8: 82,048,489 I772N probably damaging Het
Iqca A G 1: 90,089,516 L390P possibly damaging Het
Itgb2 C T 10: 77,560,248 R586W probably benign Het
Itih1 A G 14: 30,933,475 S588P possibly damaging Het
Iyd T A 10: 3,547,166 probably null Het
Kl A G 5: 150,988,960 K725E probably benign Het
Layn T A 9: 51,057,397 M349L probably benign Het
Map3k5 T C 10: 20,024,937 Y286H probably damaging Het
Med4 C T 14: 73,518,032 probably benign Het
Mfn1 T A 3: 32,534,251 N42K possibly damaging Het
Mindy2 T C 9: 70,656,592 D152G probably benign Het
Mrc2 A G 11: 105,347,856 probably null Het
Mrpl11 C A 19: 4,962,469 A26E probably damaging Het
Msh6 G A 17: 87,986,140 W774* probably null Het
Mtch1 A T 17: 29,342,867 V121E probably damaging Het
Mtg2 G T 2: 180,084,130 E178* probably null Het
Nbas A T 12: 13,441,509 N1461Y probably damaging Het
Ndfip2 A G 14: 105,287,770 T65A probably benign Het
Ninl G T 2: 150,944,583 Q1146K probably damaging Het
Notch1 T C 2: 26,460,861 D2089G possibly damaging Het
Notch3 C T 17: 32,147,844 V906M probably damaging Het
Olfr606 A G 7: 103,452,164 I276V probably benign Het
Olfr711 A G 7: 106,971,568 Y259H probably damaging Het
Osmr A T 15: 6,844,410 Y169N probably benign Het
Ovgp1 T C 3: 105,977,717 V124A possibly damaging Het
Pde4dip T C 3: 97,724,218 Q1125R probably damaging Het
Podn A T 4: 108,021,695 V180E probably damaging Het
Pold1 A T 7: 44,539,118 V475E probably damaging Het
Polg A G 7: 79,461,720 I261T possibly damaging Het
Satb1 G T 17: 51,740,410 Q595K probably benign Het
Scaf8 T A 17: 3,164,132 probably null Het
Serpinb3a C T 1: 107,047,472 probably null Het
Slc22a26 T C 19: 7,802,115 D112G probably damaging Het
Slc25a23 A G 17: 57,045,562 F441L probably benign Het
Slc25a53 T C X: 136,983,467 T42A probably damaging Het
Slc6a15 T C 10: 103,393,408 Y103H probably damaging Het
Slx4 A G 16: 3,986,359 S864P probably benign Het
Snap91 T C 9: 86,825,077 E220G probably damaging Het
Spam1 T C 6: 24,796,268 F73L probably damaging Het
Sphkap C T 1: 83,277,989 V393M probably benign Het
Spred2 T C 11: 20,021,241 Y370H probably damaging Het
Sqle T C 15: 59,323,729 probably null Het
Srrm2 A G 17: 23,818,263 T1390A probably benign Het
Tas1r2 A G 4: 139,669,041 R564G possibly damaging Het
Tbl2 G T 5: 135,156,520 probably null Het
Tcof1 T C 18: 60,831,829 D606G possibly damaging Het
Tdpoz3 T A 3: 93,826,780 L254H probably damaging Het
Trpm1 A T 7: 64,234,988 I806F probably damaging Het
Ttc22 A G 4: 106,639,040 D429G probably benign Het
Ube2o C A 11: 116,581,146 G90C probably damaging Het
Usp34 T A 11: 23,382,602 F1110I probably damaging Het
Vmn2r82 T C 10: 79,378,888 L235P probably damaging Het
Vps35 A G 8: 85,286,500 V116A probably benign Het
Wdfy3 A G 5: 101,898,425 probably null Het
Zeb2 T C 2: 44,988,809 K1138E probably benign Het
Zfp513 G A 5: 31,200,522 T169I probably benign Het
Zfp629 T C 7: 127,612,379 D86G probably benign Het
Other mutations in P2rx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:P2rx1 APN 11 73013000 critical splice donor site probably null
IGL01109:P2rx1 APN 11 73008215 missense probably damaging 0.99
IGL02466:P2rx1 APN 11 73009584 critical splice acceptor site probably null
IGL02524:P2rx1 APN 11 73009648 missense probably damaging 1.00
IGL02536:P2rx1 APN 11 73012474 missense probably damaging 1.00
PIT4382001:P2rx1 UTSW 11 73009200 missense probably benign 0.09
R0479:P2rx1 UTSW 11 73012961 missense probably damaging 1.00
R1238:P2rx1 UTSW 11 73012958 missense probably damaging 1.00
R4016:P2rx1 UTSW 11 73009973 missense probably damaging 1.00
R5345:P2rx1 UTSW 11 73009230 missense probably damaging 1.00
R5440:P2rx1 UTSW 11 73008503 missense probably benign
R6172:P2rx1 UTSW 11 73010030 missense probably damaging 0.99
R6285:P2rx1 UTSW 11 73008148 missense probably benign 0.22
R6348:P2rx1 UTSW 11 72999322 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTCAAGTATGCGGAGGACATG -3'
(R):5'- AAGTGTGGATCTGGACCCAG -3'

Sequencing Primer
(F):5'- AGGTGAGCTTCATCTTCTTGAGCTC -3'
(R):5'- AGAGCTCTGGATTCCAATGTC -3'
Posted On2014-10-01